ID: 1203731796

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:98543-98565
Sequence GGTCCCTGGAGCCCCCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203731796_1203731801 0 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731801 Un_GL000216v2:98566-98588 ACCCCAGGCCCGGCGATGCCCGG No data
1203731796_1203731813 19 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731813 Un_GL000216v2:98585-98607 CCGGGCTCGGAGGGAGCCCCTGG No data
1203731796_1203731810 10 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731810 Un_GL000216v2:98576-98598 CGGCGATGCCCGGGCTCGGAGGG No data
1203731796_1203731815 27 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731815 Un_GL000216v2:98593-98615 GGAGGGAGCCCCTGGTGCGAGGG No data
1203731796_1203731809 9 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731809 Un_GL000216v2:98575-98597 CCGGCGATGCCCGGGCTCGGAGG No data
1203731796_1203731806 6 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731806 Un_GL000216v2:98572-98594 GGCCCGGCGATGCCCGGGCTCGG No data
1203731796_1203731798 -10 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731798 Un_GL000216v2:98556-98578 TCCAGGGACCACCCCAGGCCCGG No data
1203731796_1203731803 1 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731803 Un_GL000216v2:98567-98589 CCCCAGGCCCGGCGATGCCCGGG No data
1203731796_1203731814 26 Left 1203731796 Un_GL000216v2:98543-98565 CCGTCAGGGGGGCTCCAGGGACC No data
Right 1203731814 Un_GL000216v2:98592-98614 CGGAGGGAGCCCCTGGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203731796 Original CRISPR GGTCCCTGGAGCCCCCCTGA CGG (reversed) Intergenic
No off target data available for this crispr