ID: 1203732765

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:105835-105857
Sequence CTTTACTTCTTGATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203732761_1203732765 -9 Left 1203732761 Un_GL000216v2:105821-105843 CCTCAGAACCTGGGCTTTACTTC 0: 5
1: 0
2: 0
3: 27
4: 450
Right 1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG No data
1203732757_1203732765 20 Left 1203732757 Un_GL000216v2:105792-105814 CCAAACATGGTCTCCAGATGGAG 0: 5
1: 0
2: 0
3: 10
4: 147
Right 1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG No data
1203732758_1203732765 7 Left 1203732758 Un_GL000216v2:105805-105827 CCAGATGGAGTCTGTTCCTCAGA 0: 4
1: 1
2: 2
3: 13
4: 137
Right 1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203732765 Original CRISPR CTTTACTTCTTGATGGGAGA AGG Intergenic
No off target data available for this crispr