ID: 1203736064

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:140667-140689
Sequence CTTTTATAAGCTCTGTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203736064_1203736065 -7 Left 1203736064 Un_GL000216v2:140667-140689 CCTGTAGACAGAGCTTATAAAAG No data
Right 1203736065 Un_GL000216v2:140683-140705 ATAAAAGTGTTACATCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203736064 Original CRISPR CTTTTATAAGCTCTGTCTAC AGG (reversed) Intergenic
No off target data available for this crispr