ID: 1203738766

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161210-161232
Sequence GGCCCCGGGCTTCCACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738766_1203738776 22 Left 1203738766 Un_GL000216v2:161210-161232 CCTCCCAGTGGAAGCCCGGGGCC No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738766_1203738775 3 Left 1203738766 Un_GL000216v2:161210-161232 CCTCCCAGTGGAAGCCCGGGGCC No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738766 Original CRISPR GGCCCCGGGCTTCCACTGGG AGG (reversed) Intergenic