ID: 1203738770

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161214-161236
Sequence CCCCGGCCCCGGGCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738770_1203738775 -1 Left 1203738770 Un_GL000216v2:161214-161236 CCAGTGGAAGCCCGGGGCCGGGG No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738770_1203738776 18 Left 1203738770 Un_GL000216v2:161214-161236 CCAGTGGAAGCCCGGGGCCGGGG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738770 Original CRISPR CCCCGGCCCCGGGCTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr