ID: 1203738772

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161224-161246
Sequence CTTTCGTCGTCCCCGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738772_1203738776 8 Left 1203738772 Un_GL000216v2:161224-161246 CCCGGGGCCGGGGACGACGAAAG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738772 Original CRISPR CTTTCGTCGTCCCCGGCCCC GGG (reversed) Intergenic