ID: 1203738773

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161225-161247
Sequence TCTTTCGTCGTCCCCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738773_1203738776 7 Left 1203738773 Un_GL000216v2:161225-161247 CCGGGGCCGGGGACGACGAAAGA No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738773_1203738782 30 Left 1203738773 Un_GL000216v2:161225-161247 CCGGGGCCGGGGACGACGAAAGA No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738773 Original CRISPR TCTTTCGTCGTCCCCGGCCC CGG (reversed) Intergenic