ID: 1203738774

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161231-161253
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738774_1203738782 24 Left 1203738774 Un_GL000216v2:161231-161253 CCGGGGACGACGAAAGAGACTTG No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data
1203738774_1203738776 1 Left 1203738774 Un_GL000216v2:161231-161253 CCGGGGACGACGAAAGAGACTTG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738774 Original CRISPR CAAGTCTCTTTCGTCGTCCC CGG (reversed) Intergenic