ID: 1203738775

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161236-161258
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738766_1203738775 3 Left 1203738766 Un_GL000216v2:161210-161232 CCTCCCAGTGGAAGCCCGGGGCC No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738770_1203738775 -1 Left 1203738770 Un_GL000216v2:161214-161236 CCAGTGGAAGCCCGGGGCCGGGG No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738760_1203738775 17 Left 1203738760 Un_GL000216v2:161196-161218 CCTTCGGACGGCACCCTCCCAGT No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738765_1203738775 4 Left 1203738765 Un_GL000216v2:161209-161231 CCCTCCCAGTGGAAGCCCGGGGC No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738768_1203738775 0 Left 1203738768 Un_GL000216v2:161213-161235 CCCAGTGGAAGCCCGGGGCCGGG No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738758_1203738775 24 Left 1203738758 Un_GL000216v2:161189-161211 CCCAACACCTTCGGACGGCACCC No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738759_1203738775 23 Left 1203738759 Un_GL000216v2:161190-161212 CCAACACCTTCGGACGGCACCCT No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738757_1203738775 27 Left 1203738757 Un_GL000216v2:161186-161208 CCTCCCAACACCTTCGGACGGCA No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data
1203738756_1203738775 28 Left 1203738756 Un_GL000216v2:161185-161207 CCCTCCCAACACCTTCGGACGGC No data
Right 1203738775 Un_GL000216v2:161236-161258 GACGACGAAAGAGACTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738775 Original CRISPR GACGACGAAAGAGACTTGTT TGG Intergenic