ID: 1203738776

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161255-161277
Sequence TTGGACCCCGAGCCAAAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738768_1203738776 19 Left 1203738768 Un_GL000216v2:161213-161235 CCCAGTGGAAGCCCGGGGCCGGG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738766_1203738776 22 Left 1203738766 Un_GL000216v2:161210-161232 CCTCCCAGTGGAAGCCCGGGGCC No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738770_1203738776 18 Left 1203738770 Un_GL000216v2:161214-161236 CCAGTGGAAGCCCGGGGCCGGGG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738774_1203738776 1 Left 1203738774 Un_GL000216v2:161231-161253 CCGGGGACGACGAAAGAGACTTG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738773_1203738776 7 Left 1203738773 Un_GL000216v2:161225-161247 CCGGGGCCGGGGACGACGAAAGA No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738765_1203738776 23 Left 1203738765 Un_GL000216v2:161209-161231 CCCTCCCAGTGGAAGCCCGGGGC No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data
1203738772_1203738776 8 Left 1203738772 Un_GL000216v2:161224-161246 CCCGGGGCCGGGGACGACGAAAG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738776 Original CRISPR TTGGACCCCGAGCCAAAGCG AGG Intergenic