ID: 1203738776

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161255-161277
Sequence TTGGACCCCGAGCCAAAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 27, 1: 10, 2: 7, 3: 4, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738768_1203738776 19 Left 1203738768 Un_GL000216v2:161213-161235 CCCAGTGGAAGCCCGGGGCCGGG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738766_1203738776 22 Left 1203738766 Un_GL000216v2:161210-161232 CCTCCCAGTGGAAGCCCGGGGCC No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738765_1203738776 23 Left 1203738765 Un_GL000216v2:161209-161231 CCCTCCCAGTGGAAGCCCGGGGC No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738772_1203738776 8 Left 1203738772 Un_GL000216v2:161224-161246 CCCGGGGCCGGGGACGACGAAAG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738774_1203738776 1 Left 1203738774 Un_GL000216v2:161231-161253 CCGGGGACGACGAAAGAGACTTG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738770_1203738776 18 Left 1203738770 Un_GL000216v2:161214-161236 CCAGTGGAAGCCCGGGGCCGGGG No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41
1203738773_1203738776 7 Left 1203738773 Un_GL000216v2:161225-161247 CCGGGGCCGGGGACGACGAAAGA No data
Right 1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG 0: 27
1: 10
2: 7
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738776 Original CRISPR TTGGACCCCGAGCCAAAGCG AGG Intergenic
907959214 1:59263001-59263023 TTGGACCCTGGGCCAATGAGTGG - Intergenic
910362683 1:86430009-86430031 TTGGACCTCGAGGCAAAGGAAGG - Intronic
911050056 1:93663351-93663373 TTGGACCCTGAGCCAGACCCAGG - Intronic
912460350 1:109826716-109826738 TTTGACCCCTAGCCCAAGCCTGG - Intergenic
918051323 1:180975245-180975267 TTGGACCCAGAGCCAGAACTCGG - Exonic
1068292303 10:55019951-55019973 TTGAACCCCCAGCCAAATCAAGG + Intronic
1074865378 10:117541935-117541957 TGGGACCTCGAGGCTAAGCGTGG + Intergenic
1076948654 10:133667225-133667247 TTGGACCCCGAGCCAAAGCGAGG + Exonic
1076949638 10:133670524-133670546 TTGGACCCCGAGCCAAAGCGAGG + Intronic
1076950622 10:133673823-133673845 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076951612 10:133677133-133677155 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076952602 10:133680443-133680465 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076953585 10:133683742-133683764 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076955558 10:133743404-133743426 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076956548 10:133746714-133746736 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076957536 10:133750023-133750045 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076958520 10:133753322-133753344 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076959509 10:133756632-133756654 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1076960493 10:133759931-133759953 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1077365416 11:2159577-2159599 CTGGACCCTGAGCCACAGGGTGG + Intronic
1085873007 11:80372465-80372487 TTGTAACCCCAACCAAAGCGTGG - Intergenic
1090403842 11:126465771-126465793 TTGAACCCCAAGCCAAAGCCCGG + Intronic
1094818835 12:34209581-34209603 TTGGACCCCGAGTGAAAGGGAGG - Intergenic
1102493587 12:113304227-113304249 TGGGACCCAGATCCAAAGCCAGG + Intronic
1202849566 14_GL000225v1_random:8462-8484 TTGCACCCCGAGCCAAAGCTAGG + Intergenic
1202851565 14_GL000225v1_random:23438-23460 TTGGACCCCGAGGCAAAGCGAGG + Intergenic
1202852444 14_GL000225v1_random:30142-30164 TAGGACCCCGAGGCAAAGAGAGG + Intergenic
1202854618 14_GL000225v1_random:42877-42899 TTGGAACCCGAGCCAAAGCGAGG + Intergenic
1202856068 14_GL000225v1_random:52899-52921 TTGGACCCCGAGTCAAAGTGAGG + Intergenic
1202857040 14_GL000225v1_random:58171-58193 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1202858331 14_GL000225v1_random:64846-64868 GTGGACCCCGAGCCAAATCGAGG - Intergenic
1202859647 14_GL000225v1_random:73132-73154 TTGGACCCCGAGGCAAAGCGAGG - Intergenic
1202860814 14_GL000225v1_random:79964-79986 TTGGACCCCGACCCAAAGCGAGG - Intergenic
1202862321 14_GL000225v1_random:90422-90444 TTGCACCCCGAGCCAAAGTGAGG - Intergenic
1202865564 14_GL000225v1_random:114903-114925 TTGGACCCCGAGCCAAAGCGAGG - Intergenic
1202868350 14_GL000225v1_random:136976-136998 TTGGACCCTGAGCCAAAGCGAGG - Intergenic
1202921842 14_KI270723v1_random:34743-34765 TTGGACCCTGAGCCAAAGCAAGG + Intergenic
1202923074 14_KI270724v1_random:2838-2860 TTGGACCCCTAGCCAAAGCGAGG - Intergenic
1124341740 15:28894392-28894414 TTGGACCCAGAGCCAGAATGGGG - Intronic
1124965437 15:34429575-34429597 TTGGACCCAGAGCCAGAATGGGG + Intronic
1124982056 15:34575777-34575799 TTGGACCCAGAGCCAGAATGGGG + Intronic
1129749580 15:78052075-78052097 TGGGACCCAGAGCCAGAGCTGGG - Intronic
1136924267 16:34356861-34356883 TTAGACCACGAGCCAAAATGAGG + Intergenic
1136980306 16:35054945-35054967 TTAGACCACGAGCCAAAATGAGG - Intergenic
1145902206 17:28496395-28496417 TTGGTCCCCAAGCCAGAGGGAGG - Intronic
1163282490 19:16325897-16325919 CTGGAGGCCAAGCCAAAGCGCGG + Exonic
1167643967 19:50695859-50695881 GTGGACCCCGAGCCAGCGCGGGG + Intronic
928865261 2:35910095-35910117 TTGTACCCAGAGCCTAAGCACGG + Intergenic
1171780376 20:29411504-29411526 TTGGACCCCGAGCCAAAGCGAGG - Intergenic
1172803818 20:37597211-37597233 TTGGACCCTGGGCCAAATTGAGG + Intergenic
1175271062 20:57734478-57734500 TAGGAACCAGAGCCACAGCGGGG - Intergenic
1177198505 21:17928462-17928484 TTGGATACAGAGACAAAGCGGGG + Intronic
1184609836 22:45595725-45595747 TCTGACTCCCAGCCAAAGCGTGG - Intronic
1184865277 22:47198814-47198836 GTGGACCCCGAGCTGAAGTGGGG - Intergenic
957084711 3:75669005-75669027 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
957146096 3:76425718-76425740 TTGTACCCAAAGCCAAAGCTCGG + Intronic
959536908 3:107496941-107496963 TTGGACCCTGAGTCAAAGTAAGG - Intergenic
968975884 4:3821838-3821860 CAGGCCCCCGAGCCAAAGCCTGG - Intergenic
973062240 4:45742013-45742035 TTGTAGCCAGAGCCAAAGCTTGG - Intergenic
980558765 4:134443121-134443143 ATGGACGGCGAGCCAAAGCAGGG - Intergenic
985446264 4:190022569-190022591 TTGGACCCCGAGCCAAAGCGAGG - Intergenic
985452108 4:190068009-190068031 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
985453092 4:190071306-190071328 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985454082 4:190074599-190074621 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985455070 4:190077892-190077914 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985456058 4:190081192-190081214 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985457042 4:190084486-190084508 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
985458029 4:190087779-190087801 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985459018 4:190091079-190091101 TTGGACCCCGAGCCAAAGCGAGG + Exonic
985463271 4:190173848-190173870 TTGGACCCCGAGCCAAAGCGAGG + Exonic
988314729 5:29610121-29610143 TGGGACCCAGAGCCAGAGGGTGG - Intergenic
996717728 5:126601154-126601176 TAGGAGCCCGGGCCAGAGCGAGG + Intronic
997594305 5:135095963-135095985 GTGGATCCCAAGCCAAAGCCTGG + Intronic
1002880941 6:1251731-1251753 TTGGATCTGGAGCCAAAACGTGG + Intergenic
1016461931 6:144286582-144286604 TCGGACCCCGGGCCAAAGCGGGG - Intronic
1035655311 8:1300941-1300963 GTGGACACCGAGCCACAGGGAGG - Intergenic
1039146391 8:34451706-34451728 ATGGACCGTGAGCCAAAGCAGGG - Intergenic
1041212657 8:55568662-55568684 ATGGACCCAGGGCCAAAGCCAGG + Intergenic
1059864998 9:118504681-118504703 ATGGACCATGAGCCAAAGCAGGG + Intergenic
1203736428 Un_GL000216v2:143292-143314 TTGGACCCTGAGCCAAAGCGAGG + Intergenic
1203738776 Un_GL000216v2:161255-161277 TTGGACCCCGAGCCAAAGCGAGG + Intergenic
1187043171 X:15618188-15618210 TTGGATCCCGACCCAAATGGTGG + Intergenic
1190916544 X:54815429-54815451 TCGGACCCTGGGCCAAAGCCCGG + Exonic
1193811313 X:86054696-86054718 TTGGAGCGTGAGCCAAAGCAGGG - Intergenic
1195770997 X:108351067-108351089 TGGGACCCCGAGGCTAAGCTTGG - Intronic
1201175608 Y:11306992-11307014 TTGGACCCGGAGCCAAAGTGAGG + Intergenic
1201176871 Y:11314995-11315017 TTGGACCCCGAGCCAAAGTGAGG + Intergenic
1201178001 Y:11321632-11321654 TTGGACCCCGAGCCAAAGGGAGG + Intergenic
1201179571 Y:11332405-11332427 TTGGACCCCGAGCCAAAGCCAGG + Intergenic