ID: 1203738782

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:161278-161300
Sequence CCCTGCAAGCCTGCTTTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203738778_1203738782 -6 Left 1203738778 Un_GL000216v2:161261-161283 CCCGAGCCAAAGCGAGGCCCTGC No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data
1203738779_1203738782 -7 Left 1203738779 Un_GL000216v2:161262-161284 CCGAGCCAAAGCGAGGCCCTGCA No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data
1203738774_1203738782 24 Left 1203738774 Un_GL000216v2:161231-161253 CCGGGGACGACGAAAGAGACTTG No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data
1203738777_1203738782 -5 Left 1203738777 Un_GL000216v2:161260-161282 CCCCGAGCCAAAGCGAGGCCCTG No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data
1203738773_1203738782 30 Left 1203738773 Un_GL000216v2:161225-161247 CCGGGGCCGGGGACGACGAAAGA No data
Right 1203738782 Un_GL000216v2:161278-161300 CCCTGCAAGCCTGCTTTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203738782 Original CRISPR CCCTGCAAGCCTGCTTTGAG CGG Intergenic