ID: 1203739878

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:170092-170114
Sequence TACATCACCTGTTTGATCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203739878_1203739879 -10 Left 1203739878 Un_GL000216v2:170092-170114 CCGCAGATCAAACAGGTGATGTA No data
Right 1203739879 Un_GL000216v2:170105-170127 AGGTGATGTAACCCTTGTCAAGG 0: 13
1: 42
2: 282
3: 500
4: 644
1203739878_1203739884 5 Left 1203739878 Un_GL000216v2:170092-170114 CCGCAGATCAAACAGGTGATGTA No data
Right 1203739884 Un_GL000216v2:170120-170142 TGTCAAGGTTCTGCTTACAGGGG No data
1203739878_1203739883 4 Left 1203739878 Un_GL000216v2:170092-170114 CCGCAGATCAAACAGGTGATGTA No data
Right 1203739883 Un_GL000216v2:170119-170141 TTGTCAAGGTTCTGCTTACAGGG No data
1203739878_1203739882 3 Left 1203739878 Un_GL000216v2:170092-170114 CCGCAGATCAAACAGGTGATGTA No data
Right 1203739882 Un_GL000216v2:170118-170140 CTTGTCAAGGTTCTGCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203739878 Original CRISPR TACATCACCTGTTTGATCTG CGG (reversed) Intergenic
No off target data available for this crispr