ID: 1203740054

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:171068-171090
Sequence GTCTCACAAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203740054_1203740062 16 Left 1203740054 Un_GL000216v2:171068-171090 CCCACAGGGGGCTTTTGTGAGAC No data
Right 1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203740054 Original CRISPR GTCTCACAAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr