ID: 1203740062

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:171107-171129
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 9, 1: 10, 2: 35, 3: 72, 4: 786}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203740055_1203740062 15 Left 1203740055 Un_GL000216v2:171069-171091 CCACAGGGGGCTTTTGTGAGACA No data
Right 1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786
1203740054_1203740062 16 Left 1203740054 Un_GL000216v2:171068-171090 CCCACAGGGGGCTTTTGTGAGAC No data
Right 1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786
1203740053_1203740062 27 Left 1203740053 Un_GL000216v2:171057-171079 CCTGGGTCTCTCCCACAGGGGGC No data
Right 1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203740062 Original CRISPR CCCCGTGCTCCAGCCCAGCC AGG Intergenic
900095481 1:938400-938422 CCTTGTCCACCAGCCCAGCCAGG - Intronic
900095621 1:938962-938984 GCCCCTGCTCCAGCTCAGCCTGG - Intronic
900123965 1:1061429-1061451 TCCCCGGCTCCAGCCCACCCTGG - Intergenic
900137036 1:1122073-1122095 CCCCAGCCTCCTGCCCAGCCAGG - Intergenic
900154215 1:1197626-1197648 CCGCATGCCCCAGACCAGCCGGG + Exonic
900181927 1:1314953-1314975 CCCCGTGTTCCAGAGCTGCCTGG - Exonic
900464135 1:2815825-2815847 CCTCGTCCTCCTGCCCAGCATGG - Intergenic
900538253 1:3189699-3189721 CACCGTGCTCTAGGCCAGCACGG - Intronic
900556096 1:3281318-3281340 ACCTGTGCTCCAGACCAGGCTGG + Intronic
900584056 1:3424058-3424080 CACCGTCGCCCAGCCCAGCCGGG + Intronic
900603944 1:3515587-3515609 CTCCCTGCTCCATGCCAGCCAGG - Intronic
900622272 1:3592946-3592968 CCCCCAGCCTCAGCCCAGCCCGG + Intronic
901104845 1:6747171-6747193 ACCCTTGCTCAAGCCCAGACTGG + Intergenic
901161583 1:7180719-7180741 CCCGGTGCTCAAGACCAGCCTGG - Intronic
901209863 1:7518653-7518675 CTCCCTGCACCAGGCCAGCCCGG - Intronic
901274263 1:7978631-7978653 CCCCGAGTTCGAGACCAGCCTGG + Intronic
901460140 1:9386454-9386476 TCCAGTGCTCCGGCCCATCCTGG + Intergenic
901694162 1:10994136-10994158 CCACGTGTTCCAGACCAGCCTGG + Intergenic
902007588 1:13244680-13244702 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
902026562 1:13388509-13388531 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
902295782 1:15466056-15466078 CCACCTGCTCCAGCTCTGCCTGG + Exonic
902350915 1:15853705-15853727 CACTGCACTCCAGCCCAGCCTGG - Intronic
902374332 1:16023219-16023241 CCGCTGGCTGCAGCCCAGCCTGG - Intronic
902375730 1:16029184-16029206 CCCAGAACTCCAGCCCACCCTGG + Exonic
902380681 1:16050933-16050955 CCCAGAACTCCAGCCCACCCTGG + Exonic
902765670 1:18613204-18613226 CCCAGAGCTCCAACCCTGCCTGG + Intergenic
902770431 1:18642720-18642742 CCCCCTGCTCCACCCCAGCCGGG - Intronic
902808359 1:18874651-18874673 ACCCCTGCTCCAGCCCACACTGG + Intronic
902833376 1:19032263-19032285 CATCGCTCTCCAGCCCAGCCCGG - Intergenic
902955560 1:19922442-19922464 GCCCCTGGTCCAGCCCAGCCTGG - Intronic
903050354 1:20595799-20595821 CACTGCACTCCAGCCCAGCCCGG + Intronic
903055546 1:20633684-20633706 CCCGGTCCTGCGGCCCAGCCTGG - Exonic
903071489 1:20729025-20729047 CCCCACCGTCCAGCCCAGCCAGG + Intronic
903153281 1:21428199-21428221 GCCCGCGCTCCGGCCCGGCCCGG - Intergenic
903205769 1:21781522-21781544 CCCAGAGCTCGAGACCAGCCTGG + Intronic
903353805 1:22734098-22734120 CCCCCTGCCCAAGCCCAGGCTGG - Intronic
903367108 1:22811827-22811849 CCCAGAGTTCCAGACCAGCCTGG + Intronic
903379828 1:22888943-22888965 CCAGGAGCTCCAGACCAGCCTGG + Intronic
903943245 1:26945997-26946019 GGCCCTGCTCCTGCCCAGCCTGG + Intronic
905297265 1:36962098-36962120 GCCGGTGCTCCTGCCCCGCCTGG - Intronic
905335774 1:37243692-37243714 CACTGTCCTGCAGCCCAGCCCGG - Intergenic
905684652 1:39900263-39900285 CCCAATGCTCCATCCCAACCAGG - Intronic
905786151 1:40759323-40759345 CCACGTGTTCAAGACCAGCCTGG + Intronic
906224769 1:44112615-44112637 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
906376778 1:45302932-45302954 CCACGAGTTCCAGACCAGCCTGG + Intronic
907237722 1:53063069-53063091 CCCCGAGCCACAGCCCGGCCTGG + Intronic
908036635 1:60061727-60061749 CCAGGAGCTCCAGACCAGCCTGG + Intronic
908362559 1:63383150-63383172 CCCTGTGCTCCAGCACAGGCTGG + Intronic
909114046 1:71512624-71512646 CTCAGTGCTCCACTCCAGCCTGG - Intronic
909376129 1:74944144-74944166 CCACGAGTTCCAGACCAGCCTGG + Intergenic
909497209 1:76291423-76291445 CTCGCTGCCCCAGCCCAGCCGGG + Intronic
910644811 1:89502553-89502575 CCCTGTGCTCCAGACCAGCCTGG + Intergenic
910933443 1:92465219-92465241 CCAGGAGCTCCAGGCCAGCCTGG + Intergenic
911863043 1:102979245-102979267 CCCGGAGTTCCAGGCCAGCCTGG - Intronic
912501004 1:110121800-110121822 CCCCTCCCTGCAGCCCAGCCTGG + Intergenic
913017290 1:114752053-114752075 CCAGGAGCTCCAGACCAGCCTGG + Intronic
913174954 1:116265001-116265023 CCAGGAGTTCCAGCCCAGCCTGG + Intergenic
915119731 1:153621817-153621839 CACTGCACTCCAGCCCAGCCTGG + Intronic
915255827 1:154627804-154627826 CCGCGCGTTCCAGCCCAGGCAGG + Intronic
915314720 1:155021903-155021925 CACTGCACTCCAGCCCAGCCTGG - Intronic
915341393 1:155178705-155178727 CCCCGGCCTCCTGCCCGGCCTGG + Intronic
915464074 1:156085844-156085866 CCACGAGTTCCAGACCAGCCTGG + Intronic
915604463 1:156941879-156941901 CCCCGGGAGCCAGCCCAGCAGGG - Exonic
915604825 1:156943895-156943917 CCCTGAGCCCCAGGCCAGCCTGG + Intronic
915905423 1:159873350-159873372 CCCCCTTCTCCTACCCAGCCAGG + Intronic
915971081 1:160355769-160355791 CCCCAGGCTCCCACCCAGCCTGG - Intronic
916470775 1:165120055-165120077 CCCAGTGCTGCAGACCAGCATGG + Intergenic
916801159 1:168217731-168217753 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
916935799 1:169626894-169626916 CCAGGGGCTCCAGGCCAGCCTGG - Intronic
917194346 1:172449979-172450001 CCCCATTCTCCACTCCAGCCAGG - Intronic
918049671 1:180963283-180963305 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
919175478 1:194013335-194013357 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
920022542 1:202966926-202966948 CCCCGGGCTCTTACCCAGCCTGG - Intronic
920791392 1:209096347-209096369 CTCCCTGATCTAGCCCAGCCAGG - Intergenic
921185428 1:212665679-212665701 CCCTGGGCTCCTCCCCAGCCGGG + Intergenic
921833507 1:219754040-219754062 TCACTTGCTCCAGCCCAGTCTGG - Intronic
922288240 1:224187562-224187584 CCCAGTGTTCAAGACCAGCCTGG - Intronic
922665736 1:227466886-227466908 CCCCCTGATCCAGCCCAGTTTGG - Intergenic
922730233 1:227945688-227945710 CCTCCAGCTCCAGCCCCGCCTGG + Intronic
922730860 1:227948132-227948154 CCCCTTCCTCCATCCCCGCCGGG - Intergenic
922988824 1:229887436-229887458 AACCAGGCTCCAGCCCAGCCAGG - Intergenic
923224008 1:231922664-231922686 CCCAGCCCTCCAGGCCAGCCAGG + Intronic
923551689 1:234969341-234969363 CCACGTGGTCCAGCCCACACAGG + Intergenic
924220357 1:241868163-241868185 TCAGGTGCTCCAGACCAGCCTGG + Intronic
924362503 1:243255806-243255828 CCTTTTCCTCCAGCCCAGCCTGG - Intergenic
924527391 1:244864172-244864194 CCTCGTCGTCCAGCGCAGCCTGG + Exonic
924614807 1:245603841-245603863 CCCAATTCTCCACCCCAGCCTGG - Intronic
924704159 1:246485570-246485592 CCAGGTGTTCAAGCCCAGCCTGG + Intronic
1062902836 10:1158659-1158681 TCCGGAGCTCCAGACCAGCCTGG - Intergenic
1063457193 10:6192274-6192296 CACATTGATCCAGCCCAGCCTGG + Intronic
1064022841 10:11823491-11823513 CCCGTCGCTCCAGCCCTGCCCGG - Intronic
1064535727 10:16355840-16355862 CTCTGCACTCCAGCCCAGCCTGG - Intergenic
1065115295 10:22477721-22477743 CCCCGGGCTCCAGACGACCCTGG - Intergenic
1065200319 10:23306483-23306505 CACTGCACTCCAGCCCAGCCTGG + Intronic
1065210150 10:23395209-23395231 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1065220304 10:23489564-23489586 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1065934779 10:30511732-30511754 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1066404791 10:35108243-35108265 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1067059080 10:43068565-43068587 CTCAGTGCTCCAGGCCAGCAGGG - Intergenic
1067099553 10:43324652-43324674 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1067102322 10:43342493-43342515 CCTCTGGCTCCGGCCCAGCCCGG - Intergenic
1067136419 10:43611275-43611297 CCACGAGTTCCAGACCAGCCTGG - Intronic
1067385936 10:45817691-45817713 CCCCTTGGCCCTGCCCAGCCTGG + Intergenic
1067691656 10:48505726-48505748 CCCCTCTCTCCATCCCAGCCAGG - Intronic
1068090701 10:52429319-52429341 CCACGAGTTCCAGACCAGCCTGG - Intergenic
1068268688 10:54690351-54690373 CACTGCACTCCAGCCCAGCCTGG - Intronic
1069611114 10:69773214-69773236 CCCCTTGGCCAAGCCCAGCCTGG - Intergenic
1070002567 10:72391391-72391413 CACTGCACTCCAGCCCAGCCTGG + Intronic
1070159284 10:73855981-73856003 CCAGGATCTCCAGCCCAGCCTGG - Intronic
1070524250 10:77281618-77281640 CACCCTGCTCCAGCCATGCCTGG + Intronic
1070592773 10:77812229-77812251 CCCCATACTCGAGGCCAGCCTGG + Exonic
1070733565 10:78848214-78848236 CACTGTACTCCAGTCCAGCCTGG + Intergenic
1070912264 10:80128868-80128890 CCAGGTGCTCAAGACCAGCCTGG + Intergenic
1072621297 10:97081228-97081250 CCCCTTCCCCCAGCACAGCCTGG - Intronic
1072971962 10:100025155-100025177 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1073296894 10:102445749-102445771 CACTGCACTCCAGCCCAGCCTGG + Intergenic
1073336650 10:102714769-102714791 GCCCGCGCTGCAGCCCCGCCTGG - Intronic
1074352390 10:112750423-112750445 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1074447719 10:113534065-113534087 CTGCATCCTCCAGCCCAGCCAGG - Intergenic
1075387167 10:122063301-122063323 TCCCAGGCTCCTGCCCAGCCAGG + Intronic
1075389623 10:122083254-122083276 GCCCCTGCTGCAGCCCAGCAGGG + Exonic
1075556487 10:123436121-123436143 GCCTGTGCTGCAGACCAGCCTGG + Intergenic
1075721430 10:124589839-124589861 CCCCGTCCTCCAGCCCCGCTCGG + Intronic
1075728866 10:124624607-124624629 CCTCCTGCCCCAGGCCAGCCTGG - Intronic
1075734037 10:124653250-124653272 CCCCAAGCTCAAGGCCAGCCAGG + Intronic
1075968181 10:126630832-126630854 TCCAATGCTCCAGCCAAGCCTGG + Intronic
1076147407 10:128134936-128134958 CCCAGGGCTCAAGACCAGCCTGG - Intergenic
1076478778 10:130770214-130770236 CCCAGAGCTGCAGCCCAGCGTGG - Intergenic
1076564271 10:131387349-131387371 CCCAGGGCTCCAGCTCTGCCCGG + Intergenic
1076683746 10:132187528-132187550 CCCCGCGCCCCGGACCAGCCCGG - Intronic
1076733315 10:132448723-132448745 ACCCTTGCCCCAGCCCTGCCTGG + Exonic
1076733372 10:132448847-132448869 ACCCTTGCCCCAGCCCTGCCCGG + Exonic
1076737318 10:132464674-132464696 CCCCGTCCTCCCGGCCAGGCAGG + Intergenic
1076947821 10:133664485-133664507 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076948811 10:133667795-133667817 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
1076949795 10:133671094-133671116 CCCCGCGCTGCAGCCCAGCCAGG + Intronic
1076950779 10:133674393-133674415 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076951769 10:133677703-133677725 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076952758 10:133681013-133681035 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076953742 10:133684312-133684334 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076954726 10:133740664-133740686 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076955715 10:133743974-133743996 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076956705 10:133747284-133747306 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076957692 10:133750593-133750615 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076958677 10:133753892-133753914 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076959666 10:133757202-133757224 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1076960650 10:133760501-133760523 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
1077018542 11:407348-407370 CCCCATGCTCCGTCCCACCCGGG - Intronic
1077024402 11:432836-432858 CCCAGTCCTCCAGCCCAGGAGGG - Intronic
1077079951 11:720826-720848 CCTCGTGCACCAGCTCTGCCTGG - Exonic
1077191460 11:1257512-1257534 CCCCTTGATCCATTCCAGCCCGG + Exonic
1077434219 11:2531022-2531044 CCAGGTGCTCCTGCCCAGCCAGG + Intronic
1077496051 11:2886884-2886906 CACGGTGCTTCACCCCAGCCAGG + Intergenic
1078043076 11:7886607-7886629 CCACGAGTTCCAGACCAGCCTGG + Intergenic
1078170123 11:8923422-8923444 CCTCTTGCTCCAGCACAGCTTGG - Intronic
1078382684 11:10858434-10858456 CCCCGTGAATCACCCCAGCCCGG - Intronic
1078910266 11:15724523-15724545 CCCCTTCCTGCAGCCCAGCAGGG + Intergenic
1079406393 11:20150612-20150634 CCGGGAGCTCCAGACCAGCCTGG + Intergenic
1079604052 11:22343374-22343396 CCCCGAGCCCCAGTCCCGCCTGG - Intronic
1081469751 11:43358995-43359017 CGCCTTGCTCCGGCCCAGGCTGG + Exonic
1081866178 11:46361866-46361888 CCCCGAGCTCCTGCTGAGCCAGG + Intronic
1081991937 11:47342731-47342753 CCCCGTCCTTCAGCCTAGCCGGG + Exonic
1081993261 11:47348692-47348714 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1081997638 11:47375588-47375610 CCCCATCCCCCAGCCCAGCCTGG - Intronic
1083260045 11:61517971-61517993 CCCCGGCCTCCAACCCTGCCTGG + Intronic
1083607326 11:63986695-63986717 GCCCGTGCTCCCTCCCGGCCGGG - Intronic
1083624056 11:64062937-64062959 CTCCGTGCTCCAGCATGGCCTGG + Intronic
1083857017 11:65398206-65398228 CCCAGGGTTCCAGACCAGCCTGG - Intronic
1084947607 11:72647062-72647084 CCCCATGGTCCAGCCAAGCTGGG + Intronic
1084959991 11:72711381-72711403 ACCCCTGCTCCAGCCTAGGCTGG - Intronic
1085131266 11:74040848-74040870 CCAGGTGTTCGAGCCCAGCCTGG + Intronic
1085522711 11:77147710-77147732 CCCCGCGCTCCCGCCCGTCCCGG + Intronic
1087053153 11:93906054-93906076 GGTCTTGCTCCAGCCCAGCCTGG - Intergenic
1087565531 11:99852384-99852406 CCACGAGCTCAAGACCAGCCTGG - Intronic
1088137832 11:106578725-106578747 CCACGAGCTCAAGACCAGCCTGG - Intergenic
1088189102 11:107207103-107207125 CCAGGAGCTCAAGCCCAGCCTGG + Intergenic
1088418602 11:109617814-109617836 CACTGTATTCCAGCCCAGCCTGG + Intergenic
1089555146 11:119312025-119312047 CCCCTTGCCCCAGACCCGCCTGG + Intronic
1089605512 11:119639029-119639051 CCCCGGACCCCAGCCCAGCTTGG + Intronic
1089665572 11:120016162-120016184 TTCTGTGCTCCAGACCAGCCTGG + Intergenic
1089700164 11:120239948-120239970 CTGCCTGCTCCAACCCAGCCTGG - Intronic
1091221414 11:133931838-133931860 CTCCGCGCTCCATCCCAGGCTGG + Intronic
1091274784 11:134342750-134342772 CAGGGTGCTCCAGTCCAGCCTGG - Exonic
1091896308 12:4108011-4108033 CCAGGAGCTCCAGACCAGCCCGG + Intergenic
1091900880 12:4142933-4142955 ACCTGTGCTCCACCCCACCCAGG - Intergenic
1094540245 12:31357359-31357381 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1094700614 12:32867115-32867137 CCAGGTGTTCCAGACCAGCCTGG + Intronic
1094818709 12:34209013-34209035 TGCCCTGCTCCAGCCCAGCCAGG - Intergenic
1096629345 12:52915669-52915691 CACTGAACTCCAGCCCAGCCTGG + Intronic
1096666880 12:53171901-53171923 CCCAGAGCTCCAGCCCACCAGGG + Exonic
1096828078 12:54294612-54294634 CACCCTGCTCCAGCCCAGCTGGG + Intronic
1097113378 12:56679363-56679385 GCCCCTGCTGCACCCCAGCCTGG + Intronic
1097223236 12:57462324-57462346 CCCCGCGACCCAGCCCGGCCCGG - Intronic
1097547034 12:61016515-61016537 CCCAGAGCTCAAGACCAGCCTGG + Intergenic
1097886366 12:64733063-64733085 CCAGGTGTTCCAGACCAGCCTGG + Intronic
1098226820 12:68332577-68332599 CCCCGGGGTCCCGCCCAGCCCGG - Intergenic
1098951050 12:76640805-76640827 CCTCCTGCTCCAGCCTGGCCTGG + Intergenic
1100489589 12:95066290-95066312 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1101444141 12:104725357-104725379 CCTGGTTCTTCAGCCCAGCCTGG + Intronic
1101646164 12:106632726-106632748 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1101915741 12:108894331-108894353 CCCCCTGCTGCAGCCAGGCCGGG + Exonic
1102565931 12:113797503-113797525 CTCCCTGCTCCGGCCCATCCGGG + Intergenic
1102852705 12:116264916-116264938 CCCAGAGTTCAAGCCCAGCCTGG + Intronic
1102855437 12:116289245-116289267 CCAGGTGTTCCAGACCAGCCTGG + Intergenic
1103776956 12:123373115-123373137 CACTGTGCTCCAGTTCAGCCTGG - Intergenic
1104421270 12:128637611-128637633 CCACGAGTTCCAGGCCAGCCCGG - Intronic
1104751871 12:131245169-131245191 TCTGGTGCTCCAGCCCAGCGTGG + Intergenic
1104860555 12:131921243-131921265 CCCCAGCCCCCAGCCCAGCCGGG - Intronic
1104953092 12:132451204-132451226 CCCCCTGCTCCAGCCCTGGGGGG + Intergenic
1104974506 12:132546399-132546421 CCACCTGCACCCGCCCAGCCCGG - Intronic
1106458037 13:29944582-29944604 CCCAGAGTTCCAGACCAGCCTGG - Intergenic
1108714128 13:53061966-53061988 GCTCCTGATCCAGCCCAGCCTGG - Intergenic
1110206632 13:72922185-72922207 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1110719599 13:78746441-78746463 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1113350407 13:109524018-109524040 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1113420682 13:110169672-110169694 CCGGGTGCTCCTGGCCAGCCTGG + Exonic
1113618546 13:111697636-111697658 CCCTGTGCTCTGGCCCAGCAGGG - Intergenic
1113624075 13:111782897-111782919 CCCTGTGCTCTGGCCCAGCAGGG - Intergenic
1113631875 13:111893733-111893755 CCCCGTGCTCCAGCCTCGAGGGG - Intergenic
1113642424 13:111967271-111967293 CCCCGTGCTGCCCCCCAGCATGG - Intergenic
1113990728 14:16025264-16025286 CCCTCTGCTGCAGCCCAGCCAGG - Intergenic
1113991480 14:16030719-16030741 CCCACCGCTCCAGCCTAGCCAGG - Intergenic
1114042891 14:18694920-18694942 CCAGGTGCTCGAGACCAGCCTGG + Intergenic
1114570851 14:23667254-23667276 CCCCCTGCTGCTCCCCAGCCAGG + Intergenic
1114612555 14:24052258-24052280 CCCCGTGGTGCATCCCAGCCCGG + Intronic
1114700967 14:24678504-24678526 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1115564875 14:34616565-34616587 CCACGAGCTCAAGACCAGCCTGG - Intronic
1116653274 14:47621397-47621419 CCAGGAGCTCCAGTCCAGCCTGG - Intronic
1118807480 14:69250650-69250672 GTCAGTGCTCCAGCACAGCCAGG + Intergenic
1120511828 14:85424620-85424642 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1121216311 14:92251114-92251136 CCCAGTGCTCCTGCCCAGAGAGG + Intergenic
1121309735 14:92929321-92929343 CCCCCAACTCCTGCCCAGCCAGG + Intronic
1121309751 14:92929361-92929383 CCCCCAACTCCTGCCCAGCCAGG + Intronic
1121377797 14:93430425-93430447 CCCGGCGCTCCAGCCCGCCCCGG + Intronic
1121453635 14:94025040-94025062 TCCAGGGATCCAGCCCAGCCAGG + Intergenic
1121466895 14:94121598-94121620 CCCCCAGCTGCAGCCCATCCAGG + Intergenic
1122584155 14:102793017-102793039 CCACGTGTTCGAGACCAGCCTGG - Intronic
1122937285 14:104966092-104966114 CACCATCCTCCAGCCCTGCCAGG - Intronic
1123039238 14:105483653-105483675 CCCGGGGCTGCAGGCCAGCCAGG - Intergenic
1202848484 14_GL000225v1_random:1237-1259 CCCTGTGCTCCAGCCCAGCCAGG + Intergenic
1202849693 14_GL000225v1_random:9030-9052 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1202852583 14_GL000225v1_random:30712-30734 CCCCCTGCTCCAGCCCAGCCAGG + Intergenic
1202853653 14_GL000225v1_random:37004-37026 CCACGTGCTCCAGCCCAGCCTGG + Intergenic
1202854761 14_GL000225v1_random:43446-43468 CCCCGTGCTCCAGCGCAGCCAGG + Intergenic
1202856208 14_GL000225v1_random:53468-53490 CCACGTACTCCAGCCCTGCCAGG + Intergenic
1202858197 14_GL000225v1_random:64276-64298 CCCCGTGCTCCAGCCCAGCAAGG - Intergenic
1202859504 14_GL000225v1_random:72563-72585 CCCTGTGCTCCAGCCCAGCAAGG - Intergenic
1202860678 14_GL000225v1_random:79394-79416 CCCCGAGCTCCAGCCCAGCCAGG - Intergenic
1202862180 14_GL000225v1_random:89852-89874 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1202864261 14_GL000225v1_random:104909-104931 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1202921976 14_KI270723v1_random:35312-35334 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1202922952 14_KI270724v1_random:2301-2323 CCCCGTGCTCCAGCCCAGCCAGG - Intergenic
1124187381 15:27542284-27542306 CACTCTGCTCCAGCCAAGCCAGG + Intergenic
1124250990 15:28106568-28106590 CCCCGGCCTCCGGCCCCGCCTGG + Intergenic
1124414605 15:29464792-29464814 CACAGAGCTCCGGCCCAGCCTGG + Intronic
1125937517 15:43649315-43649337 CCCCCGGCCCCGGCCCAGCCCGG - Intronic
1125994530 15:44145184-44145206 CCCAGTGCTCCAGGCCATCAGGG + Intronic
1127212248 15:56785272-56785294 CCACGTACTCAAGACCAGCCTGG - Intronic
1127307134 15:57718388-57718410 CACTGTACTCCAGCCCAGCCTGG - Intronic
1128408144 15:67365153-67365175 CCACGAGTTCCAGACCAGCCTGG - Intronic
1128517328 15:68350867-68350889 GCCCTGGCTCCAGCCCACCCTGG - Intronic
1129082447 15:73052542-73052564 GCCGCTGCTCCAGCCCAGCCCGG - Exonic
1129220242 15:74128251-74128273 ACTCGGGCTCCAGCCCTGCCCGG + Exonic
1129793846 15:78361180-78361202 CCCTGTGCTCCAGCACTGCCTGG - Intergenic
1130043468 15:80425836-80425858 CCAGGTGCTCGAGACCAGCCTGG + Intronic
1130060634 15:80567394-80567416 CCCCTTGCTCCAGCCACTCCAGG + Intronic
1130834731 15:87638766-87638788 GCCAGAGCTCCTGCCCAGCCTGG - Intergenic
1131252704 15:90840660-90840682 CCTCATGCTCCAGGCCAGCCTGG + Intergenic
1132109632 15:99092990-99093012 CCCTGTCGCCCAGCCCAGCCTGG - Intergenic
1132566318 16:625221-625243 CCCCCTGCTGCAGTCCTGCCAGG + Intronic
1132665380 16:1079026-1079048 CAGCGTGTTCCCGCCCAGCCCGG - Exonic
1132666341 16:1082909-1082931 CCCCGTGGCTCTGCCCAGCCTGG - Intergenic
1132954762 16:2585717-2585739 CACCTTGCTCCAGCCCAGCTGGG + Intronic
1132996138 16:2824299-2824321 CCAGATGCCCCAGCCCAGCCAGG + Intronic
1133026366 16:2990566-2990588 GCAGGTGCTGCAGCCCAGCCAGG + Intergenic
1133743897 16:8673281-8673303 CCCAGAGCTCGAGACCAGCCTGG - Intergenic
1134518827 16:14908536-14908558 CCCAGTGCCCCTGCCCAGGCTGG + Intronic
1134555101 16:15157688-15157710 CCCAGTGCCCCTGCCCAGGCTGG - Intergenic
1134706498 16:16307191-16307213 CCCAGTGCCCCTGCCCAGGCTGG + Intergenic
1134805466 16:17120404-17120426 CTCCTTGCTCCAGGCCACCCTGG + Intronic
1134882258 16:17755892-17755914 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1134961042 16:18404933-18404955 CCCAGTGCCCCTGCCCAGGCTGG - Intergenic
1134965344 16:18487536-18487558 CCCAGTGCCCCTGCCCAGGCTGG - Intronic
1135039747 16:19109075-19109097 CACTGTACTCCAGCCCAGCCTGG + Intergenic
1135299527 16:21313532-21313554 TCCCAGGTTCCAGCCCAGCCTGG - Intergenic
1135344903 16:21680641-21680663 CCAGGAGTTCCAGCCCAGCCCGG + Intronic
1135395994 16:22132019-22132041 CCAGGTGCTCGAGACCAGCCTGG + Intronic
1135407726 16:22210003-22210025 CCCAGAGTTCAAGCCCAGCCTGG - Intronic
1135732718 16:24908005-24908027 CCCTGTGGTCCAGGCCAGCCAGG + Exonic
1136137232 16:28263913-28263935 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1136270215 16:29144091-29144113 CCCCCTGGGCCAGGCCAGCCAGG - Intergenic
1136417922 16:30114610-30114632 GCCCATGCTCCACCCCGGCCTGG + Exonic
1136502658 16:30680641-30680663 CCCGGAGTTCCAGACCAGCCTGG + Intergenic
1136582979 16:31165419-31165441 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1136909906 16:34136420-34136442 CCCTCTGCTGCAGCCCAGCCAGG - Intergenic
1136910670 16:34141843-34141865 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1136910775 16:34142559-34142581 TCCCCCTCTCCAGCCCAGCCAGG + Intergenic
1137374417 16:47940541-47940563 CTCCATCCTCCATCCCAGCCAGG + Intergenic
1137646135 16:50076395-50076417 TCCCGAGCTCAAGACCAGCCTGG - Intronic
1137674495 16:50297622-50297644 TCCCCTGCACCTGCCCAGCCTGG - Intronic
1137846211 16:51690774-51690796 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1137975469 16:53027689-53027711 CACTGCACTCCAGCCCAGCCTGG + Intergenic
1138460144 16:57143198-57143220 CCCCGGCTTCCCGCCCAGCCTGG - Intronic
1138569782 16:57862699-57862721 CCCACTGCCCCAACCCAGCCAGG + Intronic
1139210986 16:65076501-65076523 CCCTTTGATCCAGCCCATCCTGG + Intronic
1139514717 16:67446303-67446325 CCCCCAGCTCCCACCCAGCCTGG + Intronic
1139778716 16:69333375-69333397 CCAGGGGCTCCAGACCAGCCTGG - Intronic
1139890557 16:70251123-70251145 CCCCGTGCTGCAGCAGAGCCTGG - Exonic
1139912459 16:70406479-70406501 CCCCCCACTCCAGCCCAGGCTGG - Intronic
1140216213 16:73011018-73011040 CACTGTACTCCAGTCCAGCCTGG - Intronic
1140236810 16:73166546-73166568 CCCCGTGCTCTTGCCCAATCCGG - Intergenic
1140756419 16:78071549-78071571 CCCAGAGTTCCAGACCAGCCTGG + Intergenic
1140844433 16:78873004-78873026 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1141168936 16:81679037-81679059 CCCTGTGCTCCTGCACACCCTGG - Intronic
1141564537 16:84892393-84892415 ACCCTTGCTCCAGCCTGGCCTGG + Intronic
1141601056 16:85126740-85126762 CCCAGTGCCCCACCCCAGCAGGG + Intergenic
1141649056 16:85383590-85383612 CCTCCTCCTCCAGACCAGCCTGG + Intergenic
1141701495 16:85644298-85644320 CACTGCACTCCAGCCCAGCCTGG + Intronic
1141924620 16:87160005-87160027 CTCCGAGTTCAAGCCCAGCCTGG - Intronic
1141995247 16:87632940-87632962 CCCAGAGTTCCAGACCAGCCTGG - Intronic
1142143445 16:88482847-88482869 CCGCGTGCTCCCGCCAAGTCGGG + Intronic
1142609896 17:1103324-1103346 CCCCCAGCTCCAGCCCCTCCAGG + Intronic
1142683337 17:1562629-1562651 CCCCGTGGCCCGGCCCGGCCCGG + Exonic
1142838349 17:2606861-2606883 CACTGCACTCCAGCCCAGCCTGG - Intronic
1143020355 17:3914387-3914409 CCCCAAGCTGCTGCCCAGCCGGG - Intronic
1143498138 17:7324078-7324100 CCCCCAGCCCCAGCCCAGCCCGG + Intronic
1143557439 17:7670628-7670650 CCCCTGGCTCCTTCCCAGCCTGG + Exonic
1143584898 17:7846142-7846164 CTCCGGGAGCCAGCCCAGCCAGG + Exonic
1143826169 17:9609483-9609505 CCAGGAGTTCCAGCCCAGCCTGG + Intronic
1143849034 17:9795604-9795626 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1143906507 17:10213499-10213521 GCCGGAGCTCCAGACCAGCCTGG + Intergenic
1144601010 17:16613310-16613332 CACTGTGCTCCACTCCAGCCTGG + Intergenic
1145006923 17:19343486-19343508 CTCTCTGCCCCAGCCCAGCCTGG - Intronic
1145070474 17:19801361-19801383 CCAGGTGCTCGAGACCAGCCTGG + Intronic
1145361913 17:22219212-22219234 CCCGGAGTTCCAGACCAGCCTGG + Intergenic
1145765688 17:27456891-27456913 CCCGCTCCTCGAGCCCAGCCTGG - Intronic
1145935209 17:28711214-28711236 CCACGGGCTCCAGCCAAGGCCGG + Intronic
1145972924 17:28967555-28967577 CCCCTTTCTCCATCCCATCCTGG - Intronic
1146059730 17:29598116-29598138 CCCCGGAGTCCAGCCCAACCAGG + Intronic
1146231316 17:31113451-31113473 CCAGGTGCTCGAGACCAGCCTGG - Intronic
1146274265 17:31505919-31505941 CCAGGAGCTCCAGGCCAGCCTGG - Intronic
1146430833 17:32792851-32792873 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1146654417 17:34626704-34626726 CCTCGGGCTCCAGCCCGTCCGGG - Intronic
1146922421 17:36722521-36722543 CCCCGTCCTCCGTCCCAGCGTGG - Intergenic
1147585405 17:41651548-41651570 CCGCTGGCTCCAGCCCAGCCAGG + Intergenic
1147707813 17:42439588-42439610 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1147820145 17:43236689-43236711 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147821456 17:43244086-43244108 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147822255 17:43248571-43248593 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147823179 17:43254017-43254039 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147823548 17:43256160-43256182 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147823950 17:43258617-43258639 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147824221 17:43260218-43260240 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147824708 17:43263056-43263078 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147825865 17:43269540-43269562 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147827037 17:43276322-43276344 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147827885 17:43280882-43280904 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147828993 17:43287042-43287064 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147830089 17:43293185-43293207 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147831032 17:43298383-43298405 CCCCATTCTACAGCCCAGCACGG + Intergenic
1147834884 17:43322954-43322976 CCCCATTCTACAGCCCAGCACGG - Intergenic
1148128289 17:45247892-45247914 CCCCAAGATCCCGCCCAGCCCGG - Intergenic
1148339280 17:46863776-46863798 CCCCTTTCTCCAGCCCTGGCTGG + Intronic
1148355242 17:46971476-46971498 CCCAGTGCCCCACCCTAGCCTGG + Intronic
1148388816 17:47255186-47255208 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1148486566 17:47994894-47994916 CCTCCTCCCCCAGCCCAGCCTGG + Intergenic
1148496015 17:48054053-48054075 CCCTGGGTTCCTGCCCAGCCTGG + Intronic
1148733586 17:49851999-49852021 GACCCAGCTCCAGCCCAGCCTGG - Intergenic
1148742073 17:49898593-49898615 CCCCCAGCCCCAGCCCAGCCTGG + Intergenic
1148797007 17:50201837-50201859 CCCAGCCCCCCAGCCCAGCCTGG + Intergenic
1149700981 17:58655220-58655242 CCCTGCACTCCAGCCCAGCCTGG - Intronic
1151424729 17:74023586-74023608 CCATGTGCTCCACCCCAGCCTGG + Intergenic
1151476045 17:74344856-74344878 GACCGTGCGCCAGCGCAGCCGGG + Exonic
1151559925 17:74864629-74864651 CCCCAGGGTCCAGCCCAGGCAGG + Intronic
1151585246 17:75004690-75004712 GTCCCTGCTCCAGCCCTGCCAGG + Exonic
1151754906 17:76068811-76068833 CCCGGAGTTCGAGCCCAGCCTGG - Intronic
1151859781 17:76751480-76751502 CCCAGAGTTCCAGACCAGCCTGG + Intronic
1151944844 17:77313988-77314010 TCAGGTGCTCCAGACCAGCCTGG + Intronic
1151951073 17:77354489-77354511 CCAAATGCTCCTGCCCAGCCTGG + Intronic
1151971185 17:77458261-77458283 AACCTTGCTCCAGCCCACCCGGG - Intronic
1152065771 17:78111944-78111966 CCCAGTGCTCCAGGCCTGCGGGG - Exonic
1152065877 17:78112316-78112338 CCCCGTGCTCCAGGTCTGCAGGG - Exonic
1152558637 17:81067090-81067112 CCCCTGGCCCAAGCCCAGCCTGG + Intronic
1152654654 17:81514144-81514166 CCCCGTGCCCCAGGCCTCCCAGG + Intronic
1152684138 17:81685536-81685558 CCCCGTGCAGCACCCCAGCTTGG - Intronic
1152795955 17:82306435-82306457 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1152917696 17:83050699-83050721 CCCCGTGCTCCGGCAGAGGCTGG - Intronic
1153515398 18:5896184-5896206 GCTCGCGCTCCAGCCCCGCCGGG + Intergenic
1153888054 18:9485149-9485171 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1154335308 18:13460400-13460422 CCCGGAGTTCCAGCTCAGCCTGG - Intronic
1155290570 18:24337283-24337305 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1156253852 18:35377035-35377057 CCCCGGGCGCCTGCCCTGCCAGG - Intronic
1156494195 18:37515355-37515377 CCCCGAGCTTCTCCCCAGCCTGG + Intronic
1156495878 18:37524869-37524891 CCCCGCGCCCCAGCCCAGCCCGG - Intronic
1156501677 18:37564180-37564202 CCCCGTGCTCCTTCCCTGCCTGG + Intronic
1156505263 18:37586675-37586697 CCCCATCCTGCACCCCAGCCTGG + Intergenic
1156883208 18:42104907-42104929 CCCAGAGTTTCAGCCCAGCCTGG - Intergenic
1157259415 18:46165511-46165533 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1157597872 18:48874873-48874895 GCTCGAGCCCCAGCCCAGCCCGG - Intergenic
1159128691 18:64255288-64255310 CCAGGAGCTCGAGCCCAGCCTGG - Intergenic
1159720421 18:71883112-71883134 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1159798401 18:72868906-72868928 CCGCGCGCTCCAGCCCTTCCCGG - Intergenic
1159808070 18:72979852-72979874 CCAGGTGCTCGAGACCAGCCTGG - Intergenic
1160152829 18:76407875-76407897 CTCTGAGCTGCAGCCCAGCCAGG + Intronic
1160232250 18:77057241-77057263 CCCAGTGCTCCCAGCCAGCCAGG - Intronic
1160497391 18:79383447-79383469 CCCTGTGCCCCAGCCCTGCAAGG - Intergenic
1160654875 19:260441-260463 CCAGGAGCTCCAGACCAGCCAGG + Intergenic
1160665709 19:327096-327118 CCCCATACTCCACCGCAGCCAGG - Intronic
1160764227 19:800149-800171 ACCTGTGTTCCAGACCAGCCTGG - Intronic
1160786291 19:901487-901509 CCCCATCCTCCAGGCCAGGCAGG + Exonic
1160796465 19:947962-947984 CCTCGTGCACCTGACCAGCCGGG - Intronic
1160802039 19:974662-974684 CCCCGTGCACCTGCCCACCTCGG + Exonic
1160894507 19:1396297-1396319 TCCCGGGCCCCATCCCAGCCTGG - Intergenic
1160921845 19:1524285-1524307 CCCGGGACCCCAGCCCAGCCCGG - Intronic
1160962893 19:1731953-1731975 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1160981585 19:1818869-1818891 CCCCGTGGGCCATCCCAGGCAGG - Intronic
1161024223 19:2028113-2028135 CCAGGGGCTCCAGACCAGCCTGG + Intronic
1161063466 19:2226646-2226668 CCTCGCCCTTCAGCCCAGCCAGG - Exonic
1161094709 19:2383544-2383566 CCCAGAGCTCAAGACCAGCCTGG - Intergenic
1161155919 19:2731892-2731914 CCCCGTGCTCCTGCCCTCTCGGG + Intronic
1161156257 19:2733176-2733198 CCCCGTGCGCCTGCTCAGCCTGG - Exonic
1161327927 19:3672357-3672379 CCCCATCCTGCAGACCAGCCTGG + Intronic
1161376800 19:3943443-3943465 CCCGGAGTTCCAGTCCAGCCTGG + Intergenic
1161464572 19:4421565-4421587 CCACGTGTTCAAGACCAGCCTGG + Intronic
1161519956 19:4718400-4718422 CCCCTTGCCCCACGCCAGCCAGG - Intronic
1161638034 19:5401556-5401578 CCACGAGCTCAAGACCAGCCTGG + Intergenic
1161955329 19:7490990-7491012 CCCAGGGCTCAAGGCCAGCCTGG - Intronic
1162369835 19:10271876-10271898 CCCCCAGCTCCAGCCCAGCTAGG + Intronic
1162965235 19:14152387-14152409 CCCCGTGCTGCAGCCCCGTGGGG - Exonic
1163390669 19:17027947-17027969 CCCAGTGCTCAAGACCAGCCTGG - Intergenic
1163481550 19:17559521-17559543 TCCCTGCCTCCAGCCCAGCCAGG + Intronic
1163545341 19:17938128-17938150 CCAGGAGCTCCAGGCCAGCCTGG + Intronic
1164150122 19:22543184-22543206 CCCAGAGCTCAAGACCAGCCTGG + Intergenic
1164176972 19:22783881-22783903 CCCCGAGCTCTTGCCCAGCTCGG - Intronic
1164647734 19:29872106-29872128 CCCCGTGACCCAGCCCAGAGAGG + Intergenic
1164697127 19:30253667-30253689 TCCCGTCCACCCGCCCAGCCGGG - Intronic
1165064826 19:33222891-33222913 CCCTCTGCTCCAGCTCAGACTGG - Intronic
1165097036 19:33415055-33415077 CCCTGTGCGCCAGGCCAGACAGG + Intronic
1165185322 19:34015408-34015430 CCCCCTGCCCCACCCCACCCCGG - Intergenic
1165244929 19:34493391-34493413 TCCCCTGCTCCAGACCTGCCAGG + Intronic
1165310764 19:35028291-35028313 CCCCCTGGCCCAGCCCTGCCAGG - Intergenic
1165331555 19:35143315-35143337 CCCCCTGCTCCGGCCCAGCATGG + Exonic
1165361444 19:35339350-35339372 CCACGAGTTCAAGCCCAGCCTGG + Intronic
1165404087 19:35619479-35619501 CCCCGGGCTCCGGCACAGGCGGG - Exonic
1165433412 19:35784652-35784674 CCCCGGACCCCAGCCCAGTCAGG + Intronic
1166008041 19:39920549-39920571 CCATGAGCTCCAGACCAGCCTGG - Intronic
1166096157 19:40540643-40540665 CCAGGTGTTCCAGACCAGCCTGG + Intronic
1166144663 19:40825942-40825964 CTCCTGGCTCCAGCCCAGCTGGG + Intronic
1166183080 19:41122265-41122287 CTCCTGGCTCCAGCCCAGCTGGG - Intronic
1166684079 19:44784773-44784795 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1166774877 19:45306501-45306523 CCCAGAGCTCCACCCCAACCAGG - Exonic
1166986181 19:46661073-46661095 CCCCCCGCCCCAGCCCGGCCGGG + Exonic
1167148617 19:47696483-47696505 CCCCACGCTTCAGCCCAGCAAGG + Exonic
1167156426 19:47741951-47741973 CCGCTTCCTCCTGCCCAGCCAGG + Exonic
1167283396 19:48584693-48584715 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1167762021 19:51455575-51455597 CCCCCGGGTCCAGCTCAGCCTGG + Exonic
1167768216 19:51498175-51498197 CCCCCAGGTCCAGCTCAGCCTGG + Exonic
1167769447 19:51505247-51505269 CCCCCAGGTCCAGCTCAGCCTGG + Intergenic
1167909646 19:52691051-52691073 CCCTGGGGTCCAGGCCAGCCTGG + Intergenic
1167932625 19:52878893-52878915 CCCGGTACTCAAGACCAGCCTGG - Exonic
1167946748 19:52994180-52994202 CCTGGGGCTCCAGGCCAGCCTGG + Intergenic
1168019813 19:53601089-53601111 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1168304696 19:55429207-55429229 CCACTAGCTCTAGCCCAGCCTGG - Exonic
925020161 2:562679-562701 CCCCATGCTGCAGCCCCGCAGGG - Intergenic
925020174 2:562725-562747 CCCCATGCTGCAGCCCCGCAGGG - Intergenic
925316605 2:2931521-2931543 CCCCAGGATCCAGACCAGCCAGG + Intergenic
925386989 2:3468733-3468755 CCCCTTCCTACAGCCCATCCTGG - Intronic
925451665 2:3974223-3974245 CCTCATGCTCCATCCAAGCCAGG - Intergenic
925725338 2:6865843-6865865 CCCAGGGCTCCTGCCCCGCCTGG - Intronic
925976609 2:9146292-9146314 CCACGTCCTCCATCCCAGCCCGG - Intergenic
925988776 2:9236949-9236971 CTCCGTACCCCAGCCCTGCCTGG - Intronic
927142561 2:20140154-20140176 CCCTGGGCTCCTGCCCTGCCGGG + Intergenic
927491372 2:23523219-23523241 CCCTCTGCCCCAGCCCACCCTGG - Intronic
927495660 2:23550019-23550041 CTGCCTGCTCCAGCCCAGCGTGG + Intronic
927718160 2:25365931-25365953 CCCCTTGCTTGAGCTCAGCCTGG + Intergenic
927787296 2:25982568-25982590 CCCCCTGCCCCACCCCAGTCGGG - Intronic
927809418 2:26173246-26173268 GCCCATGCTCCAGCGCAGGCCGG - Exonic
928169717 2:28995409-28995431 GCCCCTGCTCCAGCCCATGCAGG - Intronic
928255351 2:29717394-29717416 CCCCGTGGACCATTCCAGCCAGG - Intronic
928264146 2:29796773-29796795 CCCCGTGCCCCACCCCACACCGG - Intronic
928432903 2:31234912-31234934 CCTGGTGCTCCATCCCAGACAGG + Intronic
929144287 2:38693053-38693075 CCTTGAGCTCCAGGCCAGCCTGG - Intronic
929574739 2:43044318-43044340 CCCCGCTCCCCAGACCAGCCTGG - Intergenic
930009462 2:46924835-46924857 CCCAGAGCTCGAGTCCAGCCTGG - Intronic
931246732 2:60498404-60498426 CCCCTCTGTCCAGCCCAGCCTGG - Intronic
931472165 2:62549217-62549239 TCCCCTTCTCCAGTCCAGCCTGG + Intergenic
931488543 2:62719174-62719196 ACCCGTGTTCAAGACCAGCCTGG - Intronic
931694223 2:64859882-64859904 ACCCCCGCTCCAGCCCAGCGGGG + Intergenic
932227852 2:70057190-70057212 CCACGTGTTCTAGACCAGCCTGG + Intergenic
932616469 2:73234539-73234561 CGCCGTGCTCGGGCCGAGCCAGG - Intronic
933478483 2:82822464-82822486 CCCAGTGTTCAAGACCAGCCTGG + Intergenic
933677297 2:85068037-85068059 CAGGGTACTCCAGCCCAGCCTGG + Intergenic
934552308 2:95269971-95269993 CCAGGAGTTCCAGCCCAGCCTGG - Intergenic
934862979 2:97779803-97779825 CCAGGTGTTCCAGACCAGCCTGG + Intronic
935332808 2:101989425-101989447 CCACGAGTTCCAGACCAGCCTGG - Intergenic
935978456 2:108602993-108603015 CCAGGTGTTCCAGACCAGCCTGG - Intronic
936087600 2:109479911-109479933 GCTCTTGCTCCAGCCCAGCCCGG + Intronic
936156417 2:110050117-110050139 TCACCTGCTCCAGCCCAGACAGG - Intergenic
936188273 2:110321327-110321349 TCACCTGCTCCAGCCCAGACAGG + Intergenic
937203084 2:120218371-120218393 CCCTGTGGTGCAGCCCTGCCTGG + Intergenic
937833164 2:126445373-126445395 GCCCCTGCTCCACTCCAGCCTGG + Intergenic
938021329 2:127908081-127908103 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
938073100 2:128318644-128318666 GCCCGCGCTCCGGCCCGGCCCGG + Intergenic
938267267 2:129937434-129937456 CCAGGTGCTCAAGACCAGCCTGG - Intergenic
939984181 2:148814022-148814044 CCTCTTCCTCCTGCCCAGCCTGG + Intergenic
944660834 2:201920325-201920347 CCAAGAGCTCCAGACCAGCCTGG - Intergenic
944885988 2:204063184-204063206 CCAAGAGCTCCAGACCAGCCTGG - Intergenic
945245322 2:207711940-207711962 CCCCGCGCGCCGGCCCAGCTTGG - Exonic
946071857 2:217040861-217040883 TCAGGTGCTCCAGCCCAGCCTGG - Intergenic
946200553 2:218068594-218068616 GCCCCTGCAGCAGCCCAGCCTGG + Intronic
947148896 2:227094151-227094173 CCTGGTGCTCCAGGCAAGCCAGG + Exonic
947212135 2:227718047-227718069 CCCCGGGCTCCGGGCCAGGCAGG - Intergenic
947623351 2:231604673-231604695 CCCCCAGCCCCAGCCCGGCCCGG + Intergenic
947716578 2:232342781-232342803 CCAGGGGCCCCAGCCCAGCCTGG - Intronic
947964775 2:234270244-234270266 CACCCTGCTCCAGCCCTGCCTGG + Intergenic
948136081 2:235637309-235637331 CACTGTACTCCAGCCCAGCCTGG - Intronic
948505996 2:238427210-238427232 CCCCGTGGACCCGGCCAGCCCGG - Intronic
948653669 2:239464129-239464151 GCCGGGGCTCCATCCCAGCCAGG - Intergenic
948810902 2:240477594-240477616 CCCGGAGTTCCAGACCAGCCTGG - Intergenic
948850622 2:240703702-240703724 CCCCATCCTGCAGCCCACCCTGG - Intergenic
949046437 2:241874564-241874586 CCCAGGGGTCCAGGCCAGCCTGG - Intergenic
1168831027 20:845322-845344 CCGCCGCCTCCAGCCCAGCCCGG + Exonic
1169073793 20:2749650-2749672 GCCCGTGGTCCAGCCCTCCCCGG - Exonic
1169363074 20:4968046-4968068 CTCCTTGCTCCAGCCCACCAAGG - Intronic
1169866600 20:10207311-10207333 CCCGGAGTTCAAGCCCAGCCTGG - Intergenic
1170190281 20:13638736-13638758 CCCCCTCCTCTAGCCCCGCCCGG + Intronic
1170619056 20:17978985-17979007 CCCGGAGCTCGAGACCAGCCTGG - Intronic
1171751369 20:29052812-29052834 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1171771150 20:29324442-29324464 CCCTCTGCTGCAGCCCAGCCAGG + Intergenic
1171780235 20:29410934-29410956 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1171813109 20:29761765-29761787 TCCCCCGCTCCAGCCCAGCCAGG + Intergenic
1171824199 20:29879198-29879220 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1171905379 20:30895123-30895145 CCCTCTGCTGCAGCCCAGCCAGG - Intergenic
1171906125 20:30900551-30900573 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1172002047 20:31786611-31786633 CCACGAGCTCAAGACCAGCCTGG - Intronic
1172231118 20:33336827-33336849 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1172610802 20:36250985-36251007 CCAGGTGTTCCAGACCAGCCTGG + Intronic
1172742192 20:37178090-37178112 GCCCGAGTTCCAGACCAGCCTGG + Intronic
1173480816 20:43397930-43397952 TCCCATTCTCCAGGCCAGCCAGG + Intergenic
1173596386 20:44261128-44261150 CTCAGGGCTCCAGCCCAGCTGGG + Intronic
1173672449 20:44808437-44808459 ACCCATGCTCCTGCCCAGCCTGG + Intronic
1175129481 20:56778820-56778842 CCCCCTGCTCCAGCCCACTGTGG + Intergenic
1175302203 20:57950998-57951020 CCCCCTGATTCAGCCCAGCGAGG + Intergenic
1175505732 20:59482962-59482984 TCCTGTGCACCAGCCCCGCCTGG - Intergenic
1175716020 20:61254164-61254186 CCCCCATCTCCAGCCCAGGCAGG - Intronic
1175806878 20:61834390-61834412 ACCTGTGCTCCAGCCCAGGCAGG + Intronic
1175863812 20:62163940-62163962 CCAGGTGCTCAAGACCAGCCTGG + Intronic
1175871133 20:62210053-62210075 CTCCCTGCTCCAGCCCTGCTGGG + Intergenic
1175984907 20:62759801-62759823 CGTCGTGCTCCCGCCCAGCCTGG - Intronic
1176025467 20:62983221-62983243 CCCCGACCTCCATTCCAGCCAGG + Intergenic
1176050267 20:63115641-63115663 CACCGTGCTGCAGCCCACCTAGG + Intergenic
1176384918 21:6134507-6134529 CCCCCTGCACCACCCCAGCAGGG - Intergenic
1178251950 21:31011578-31011600 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1178288017 21:31342233-31342255 CCAGGAGCTCCAGTCCAGCCTGG + Intronic
1178843482 21:36156531-36156553 CCCCGCCTTCCAGCCTAGCCCGG + Intergenic
1179164683 21:38926171-38926193 CTCCCTGCCCCAGCCCATCCTGG - Intergenic
1179484935 21:41704117-41704139 CACCATGCCCCCGCCCAGCCTGG + Intergenic
1179738554 21:43403745-43403767 CCCCCTGCACCACCCCAGCAGGG + Intergenic
1179794916 21:43776877-43776899 CCCCCTGCCCCCACCCAGCCTGG - Intergenic
1180034178 21:45234841-45234863 GCCTCTTCTCCAGCCCAGCCCGG + Intergenic
1180132173 21:45833836-45833858 CCCTGAGCTCCTGCCCAGGCAGG - Intronic
1180183745 21:46129493-46129515 GCCCGGGCACCCGCCCAGCCGGG + Intronic
1180240267 21:46498761-46498783 CCCAGTGCTGCAGCCACGCCGGG + Exonic
1180259752 21:46661398-46661420 CCCCGCGCCCCCGCCCTGCCTGG + Intronic
1180315788 22:11276805-11276827 CCCACCGCTCCAGCCTAGCCAGG + Intergenic
1180316542 22:11282262-11282284 CCCTCTGCTGCAGCCCAGCCAGG + Intergenic
1180338797 22:11601237-11601259 CCCTCTGCTGCAGCCCAGCCAGG - Intergenic
1180339550 22:11606670-11606692 CCCCCCGCTCCAGCCCAGCCAGG - Intergenic
1180414295 22:12694029-12694051 CCCTGTGCTCCAGGCCAGCCTGG - Intergenic
1180983520 22:19890878-19890900 CCCAGGGCTGCAGCCCACCCTGG + Intronic
1181498385 22:23301395-23301417 CCCAGTGCTCCTGCACATCCTGG - Intronic
1181809514 22:25394941-25394963 CCCTGTCCTCAAGCCCACCCAGG + Intronic
1181845770 22:25707660-25707682 TCCCGTGATCCAGCAAAGCCAGG + Intronic
1182283750 22:29232279-29232301 CCCACAGCTCCAGCCCGGCCAGG - Exonic
1182826344 22:33268161-33268183 CCAGGTGTTCCAGACCAGCCTGG - Intronic
1182946338 22:34325787-34325809 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1183311244 22:37110733-37110755 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1183368581 22:37419883-37419905 CCCTGTGCCCCTGCCCAGCGCGG + Intronic
1183374821 22:37457094-37457116 TCCCCACCTCCAGCCCAGCCAGG - Intergenic
1183486462 22:38089674-38089696 CCCCGTGTCCCCGCCCGGCCAGG - Exonic
1183782897 22:40009946-40009968 CCCCGTCCTGCCGCCCAGGCAGG + Intronic
1184163796 22:42715510-42715532 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1184201018 22:42969727-42969749 CCACGTGTTCGAGACCAGCCTGG + Intronic
1184464185 22:44659369-44659391 CCCACTCCTCCAGCCCAGCCTGG + Intergenic
1184651542 22:45921468-45921490 CACCTTTCTCCTGCCCAGCCTGG - Exonic
1184670187 22:46008175-46008197 CTGCCTGCTGCAGCCCAGCCCGG - Intergenic
1184762445 22:46552217-46552239 GCCCGAGACCCAGCCCAGCCTGG + Intergenic
1185079592 22:48702322-48702344 CCCCGAGTCCCAGCCCAGCCAGG - Intronic
1185259472 22:49853709-49853731 CTCCGTCCTCCCGCCCGGCCAGG + Intergenic
1185366200 22:50438047-50438069 CCCCGTCCTCCCCTCCAGCCCGG + Intronic
949717955 3:6955324-6955346 CCAGGAGCTCCAGACCAGCCTGG + Intronic
950565676 3:13768299-13768321 CCCCCTCCCCCAGCCCAGCTGGG - Intergenic
951877933 3:27448171-27448193 CACTGCACTCCAGCCCAGCCGGG + Intronic
953026331 3:39147366-39147388 GCCCTTGCTCCAGGCTAGCCAGG + Intronic
953033163 3:39190976-39190998 CCCTGGGCTGCAGGCCAGCCAGG + Intronic
953439548 3:42906161-42906183 CCCCGTGCTCCACACCCGCCAGG - Exonic
953683287 3:45056449-45056471 CCAGGAGCTCCAGGCCAGCCTGG - Intergenic
953912461 3:46899851-46899873 CCCCGCGCCCCATCCCAGCAAGG - Intronic
954010497 3:47632600-47632622 CCAAGAGCTCCAGACCAGCCTGG + Intronic
954329702 3:49883152-49883174 CCAAGTGTTCCAGACCAGCCTGG + Intergenic
954678916 3:52330994-52331016 CCCTCTGCTCCAGCAGAGCCAGG - Intronic
954705903 3:52480350-52480372 CCCCCAACCCCAGCCCAGCCAGG - Intronic
954710481 3:52502940-52502962 CCCTGTGTTCCTCCCCAGCCTGG + Intronic
955293513 3:57714519-57714541 CCAGGTGTTCCAGACCAGCCTGG + Intergenic
956385024 3:68707580-68707602 CCAGGAGCTCCAGTCCAGCCTGG + Intergenic
956644509 3:71442928-71442950 CACTGCACTCCAGCCCAGCCTGG - Intronic
956761874 3:72450913-72450935 CCAGGAGCTCCAGACCAGCCCGG - Intergenic
957084861 3:75669575-75669597 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
957673651 3:83339092-83339114 GCCCGAGTTCCAGACCAGCCTGG - Intergenic
957778110 3:84782247-84782269 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
958503942 3:94948352-94948374 CCCAGTGCTACACTCCAGCCTGG + Intergenic
958766361 3:98372706-98372728 CCTCCTGCTCCAGTCCAGACAGG + Intergenic
961332849 3:126153268-126153290 CCCTGTGCTCAGGACCAGCCGGG + Intronic
961446336 3:126983336-126983358 CCCCGGACCCCAGCCCGGCCCGG - Intergenic
961602543 3:128072647-128072669 CCTCAGGCTCCAGACCAGCCAGG + Intronic
961633926 3:128321211-128321233 CTCCTTGCCCCAGCCCATCCCGG - Intronic
961790360 3:129371514-129371536 CCACGAGTTCCAGTCCAGCCTGG - Intergenic
965636354 3:170785368-170785390 CCAAGAGCTCCAGACCAGCCTGG + Intronic
966180205 3:177181268-177181290 CCAGGTGTTCCAGACCAGCCTGG + Intronic
966207669 3:177421516-177421538 CAGCTTGCTCCAGCCCAACCAGG + Intergenic
967190470 3:186980230-186980252 CCCCAGGCTCCACCCCAGCTGGG - Intronic
967858442 3:194134816-194134838 CCCCCTCCTCCGGCCCCGCCGGG - Intergenic
968075819 3:195815748-195815770 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075830 3:195815793-195815815 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075842 3:195815838-195815860 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075854 3:195815883-195815905 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075866 3:195815928-195815950 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075878 3:195815973-195815995 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075891 3:195816018-195816040 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075903 3:195816063-195816085 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075915 3:195816108-195816130 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075927 3:195816153-195816175 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075939 3:195816198-195816220 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075951 3:195816243-195816265 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968075963 3:195816288-195816310 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076036 3:195816569-195816591 CCACATCCTCCTGCCCAGCCTGG + Intergenic
968076049 3:195816617-195816639 CCACATCCTCCTGCCCAGCCTGG + Intergenic
968076062 3:195816665-195816687 CCACATCCTCCTGCCCAGCCTGG + Intergenic
968076112 3:195816845-195816867 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076125 3:195816889-195816911 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076212 3:195817190-195817212 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076225 3:195817234-195817256 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076261 3:195817368-195817390 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968076312 3:195817545-195817567 CCACATCCTCCTGCCCAGCCCGG + Intergenic
968225240 3:196968905-196968927 CCCCGCGCTCCCGCCCGGCCTGG + Intronic
968283694 3:197495796-197495818 CTCCATGCCCCAGCCGAGCCCGG - Intergenic
968454302 4:689225-689247 CCCCGTGGCCCGGCCCGGCCCGG - Exonic
968468697 4:766314-766336 CCCCGTGCTTCAGCCTTGCAGGG + Exonic
969691245 4:8705370-8705392 CCCTGAGCCCCAGGCCAGCCTGG - Intergenic
969697353 4:8742176-8742198 CCCAGTGACCCACCCCAGCCAGG + Intergenic
970175055 4:13331087-13331109 CCAAGAGTTCCAGCCCAGCCTGG - Intergenic
971551610 4:27964686-27964708 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
971812697 4:31447508-31447530 CCAAGTGTTCCAGACCAGCCTGG - Intergenic
972273646 4:37536488-37536510 CTCCATGCCCCAGTCCAGCCTGG - Intronic
972322102 4:37981572-37981594 ACCCCTGCACCACCCCAGCCCGG - Intronic
973966125 4:56163955-56163977 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
974832020 4:67201395-67201417 CCCTGTGCTCCTGCCCTGCTGGG + Intergenic
975208208 4:71668481-71668503 CCCAGAGTTCAAGCCCAGCCTGG - Intergenic
975784200 4:77870101-77870123 CCAGGAGCTCGAGCCCAGCCTGG - Intronic
976620084 4:87118693-87118715 CCCAGAGCTCAAGACCAGCCTGG - Intronic
976708853 4:88047345-88047367 CCCAGAGTTCAAGCCCAGCCAGG + Intronic
980713475 4:136600824-136600846 CCCTGCACTCCAGTCCAGCCTGG + Intergenic
981552928 4:145960006-145960028 CTCAGTGCTCCAACCCAGCAGGG + Intergenic
982989178 4:162249201-162249223 CACTGCACTCCAGCCCAGCCTGG - Intergenic
983651479 4:170040625-170040647 CCCCGCTCCCCAGCTCAGCCAGG + Intergenic
983908030 4:173205438-173205460 CCCCATGCTCCAGCAGACCCAGG - Intronic
984649179 4:182251258-182251280 CCACGAGTTCCAGACCAGCCTGG + Intronic
984836918 4:184030955-184030977 CCAGGAGTTCCAGCCCAGCCTGG - Intergenic
985014100 4:185614901-185614923 CCACCTCCGCCAGCCCAGCCCGG - Exonic
985433742 4:189907169-189907191 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
985446108 4:190021999-190022021 CCCCGCGCTGCAGCCCAGCCAGG - Intergenic
985451274 4:190065284-190065306 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985452265 4:190068579-190068601 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985453249 4:190071876-190071898 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985454239 4:190075169-190075191 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985455227 4:190078462-190078484 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985456215 4:190081762-190081784 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985457199 4:190085056-190085078 CCCCGCGCTGCAGCCCAGCCAGG + Intergenic
985458186 4:190088349-190088371 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985459175 4:190091649-190091671 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
985463428 4:190174418-190174440 CCCCGCGCTGCAGCCCAGCCAGG + Exonic
986180016 5:5384508-5384530 CCCAGTACTCCAGCTCAACCTGG - Intergenic
986639505 5:9858197-9858219 CCCCAGGCTCCAGTCCGGCCTGG - Intergenic
986732407 5:10645108-10645130 GCTTGTGCTCCAGCCCAGCAGGG - Intronic
987066359 5:14293588-14293610 CCCAGTCCTCCAGCTCAGCTTGG - Intronic
987358923 5:17089093-17089115 CCCAGAGTTCCAGTCCAGCCTGG - Intronic
987442985 5:17980080-17980102 CACTGCACTCCAGCCCAGCCTGG + Intergenic
987753394 5:22069333-22069355 CCCCTTGCCCCAGCCCTGCAAGG - Intronic
989207322 5:38824012-38824034 CCACGAGTTCCAGGCCAGCCTGG + Intergenic
992883623 5:81135258-81135280 GATCGTGCTCCATCCCAGCCTGG + Intronic
993872486 5:93268491-93268513 CCTCGTGAACCTGCCCAGCCTGG + Intergenic
993997765 5:94743512-94743534 CCCCATGCTCTCACCCAGCCTGG - Intronic
994672561 5:102780087-102780109 CCCCCTGCTCCATCCAACCCAGG + Intronic
996719711 5:126618148-126618170 CCCAGAGTTCCAGACCAGCCTGG - Intronic
997345398 5:133187410-133187432 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
998122905 5:139593823-139593845 CCAGGAGCTCCAGACCAGCCTGG - Intronic
998234565 5:140387128-140387150 CCACGAGTTCCAGACCAGCCTGG - Intergenic
998328965 5:141306512-141306534 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
998335595 5:141369455-141369477 CCAGGTGTTCTAGCCCAGCCTGG + Intronic
998523938 5:142825473-142825495 TCCCGTTGTCCAGCCCAGCAGGG + Intronic
998532461 5:142898563-142898585 CCCCGTTCTCCAGTCTGGCCTGG + Intronic
998890337 5:146739227-146739249 CCCAGTGTTCCAGACCAGCTTGG - Intronic
998979168 5:147681830-147681852 CCAGGAGCTCCAGACCAGCCTGG + Intronic
999789693 5:154927780-154927802 CCCCGATCTCAAGACCAGCCTGG + Intronic
999992343 5:157061105-157061127 CCAGGAGTTCCAGCCCAGCCTGG - Intergenic
1000075757 5:157783925-157783947 CCACGTGTTCAAGGCCAGCCTGG + Intergenic
1000621094 5:163488063-163488085 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1001028515 5:168244599-168244621 CCCCACGCTGAAGCCCAGCCAGG - Exonic
1001226155 5:169946267-169946289 CCCCCACATCCAGCCCAGCCAGG + Intronic
1001550135 5:172596576-172596598 CTCCGGTCTCCAGCCCACCCAGG - Intergenic
1001579673 5:172790092-172790114 CCCCGGCCTCCAGCCCAGCTTGG - Intergenic
1001624575 5:173120588-173120610 CCAGGTGTTCCAGACCAGCCTGG - Intronic
1002050693 5:176568902-176568924 CCCTGTGCTCCCACCCAGCGGGG + Intronic
1002087632 5:176785695-176785717 CCCGCTGCCCCGGCCCAGCCTGG - Intergenic
1002201115 5:177528898-177528920 CCCTGGGTTCCACCCCAGCCTGG - Intronic
1002279047 5:178120324-178120346 CCCCGGGCCCCGGGCCAGCCAGG + Exonic
1002640876 5:180630140-180630162 CCCCTTGCTCCTGGCCAGACAGG + Intronic
1002712096 5:181201543-181201565 CCACGAGTTCCAGACCAGCCTGG + Intronic
1006170267 6:32088100-32088122 CCCTGTGCCCCAGCCCCACCTGG + Intronic
1006391649 6:33762179-33762201 CCCGTGGCCCCAGCCCAGCCTGG + Intergenic
1006434832 6:34020597-34020619 CCCAGTGCTCCAGCCCGGTCAGG - Intronic
1006649948 6:35543329-35543351 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1006828509 6:36954662-36954684 CCCACTGCCCCACCCCAGCCAGG + Exonic
1006831094 6:36968782-36968804 AGATGTGCTCCAGCCCAGCCGGG - Exonic
1007096033 6:39213813-39213835 CCCCATTTTCCAGACCAGCCTGG + Intronic
1007272164 6:40646181-40646203 CCCCCTGCTCATGCCCATCCTGG + Intergenic
1007499979 6:42289285-42289307 CACTGCGCTCCAGCCCAGCCTGG + Intronic
1007742217 6:44019487-44019509 CCAGGTGTTCCAGACCAGCCTGG + Intergenic
1008605266 6:53133701-53133723 CCAGGTGTTCCAGACCAGCCGGG - Intronic
1008738942 6:54581298-54581320 CCCAGAGTTCCAGACCAGCCTGG - Intergenic
1010488227 6:76442042-76442064 CCCTGAGTTCCAGCCCAACCAGG - Intergenic
1011472213 6:87719035-87719057 CCTCCTGCTCCAGGCCAGCTTGG - Intergenic
1013315536 6:108939026-108939048 CCAAGAGCTCCAGGCCAGCCTGG - Intronic
1013436487 6:110115051-110115073 CACTGTACTCCAGCCCAGCCTGG + Intronic
1015778023 6:136834424-136834446 CCAAGTGTTCCAGACCAGCCTGG - Intronic
1016824379 6:148374904-148374926 CCACGTGTTCGAGGCCAGCCTGG - Intronic
1017282093 6:152636712-152636734 CCCCGGGGTCCCGCCGAGCCTGG - Exonic
1017484710 6:154891909-154891931 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1018906466 6:168078905-168078927 CCTCGTGCTGCTGCCCAGCCGGG - Exonic
1018992071 6:168681849-168681871 CCCAGTGGTGCAGCCCAGCAGGG + Intergenic
1019173608 6:170148496-170148518 GCCCGTGCTGCAACCCAGCCAGG + Intergenic
1019282103 7:205772-205794 CCCCGTGCTCCTGGCCTTCCTGG + Intronic
1019424642 7:968540-968562 CCCAGTGCGTCAGGCCAGCCGGG - Exonic
1019469507 7:1211255-1211277 CCAGGTGCTCCAGCTCCGCCTGG - Intergenic
1019526440 7:1482516-1482538 GCCCCTGCCCAAGCCCAGCCTGG + Intronic
1019567555 7:1691987-1692009 ACCACTGCGCCAGCCCAGCCTGG - Intronic
1019585000 7:1795746-1795768 CCCAGTGAGCCAGCCCTGCCAGG - Intergenic
1019715612 7:2537971-2537993 CCCAGGGCTCCAGCCCAGCCCGG - Exonic
1019778030 7:2923986-2924008 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1020006430 7:4785814-4785836 CCACGAGTTCCAGACCAGCCTGG - Intronic
1021203237 7:17750223-17750245 CCAGGTGTTCCAGGCCAGCCTGG - Intergenic
1021615570 7:22499904-22499926 CCCTGTCTTCCAGCCCAGCTGGG - Intronic
1022011485 7:26311358-26311380 CCAGGGGCTCCAGACCAGCCTGG - Intronic
1022676344 7:32503264-32503286 CCCGGAGTTCGAGCCCAGCCTGG + Intronic
1023403242 7:39805999-39806021 CCAGGTGTTCCAGACCAGCCTGG + Intergenic
1023897799 7:44448694-44448716 ACCCCTGCTCCAGCTCAGGCAGG + Intronic
1024208373 7:47182910-47182932 TTCCTTGCTCCAACCCAGCCTGG - Intergenic
1024723185 7:52161426-52161448 CACAGTGCTGCACCCCAGCCTGG + Intergenic
1025829845 7:65038866-65038888 CCTCGCGCTCCTGCCCAGCCCGG - Intergenic
1025878275 7:65508738-65508760 GCCGCTGCTCGAGCCCAGCCCGG + Intergenic
1025917096 7:65873866-65873888 CCTCGCGCTCCTGCACAGCCGGG - Intronic
1026007600 7:66612325-66612347 TCAGGAGCTCCAGCCCAGCCTGG - Intergenic
1026218678 7:68372587-68372609 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1026247482 7:68634046-68634068 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1026834326 7:73628029-73628051 CCAGGTGCTCGAGACCAGCCTGG - Intergenic
1026909488 7:74083948-74083970 CCCCCAGCCCCAGCCCCGCCGGG + Exonic
1026938569 7:74273277-74273299 CACTGCACTCCAGCCCAGCCTGG + Intergenic
1027253906 7:76417821-76417843 CCAGGAGTTCCAGCCCAGCCTGG - Intronic
1027265128 7:76490644-76490666 CACTGTACTCCAGCCCAGGCTGG - Intronic
1027316499 7:76988747-76988769 CACTGTACTCCAGCCCAGGCTGG - Intergenic
1027399702 7:77794944-77794966 CCAAGAGCTCCAGACCAGCCAGG + Intronic
1027686731 7:81287701-81287723 CCCGGAGCTCGAGACCAGCCTGG - Intergenic
1028370982 7:90091982-90092004 CCAGGTGATCCAGACCAGCCTGG + Intergenic
1028468856 7:91183192-91183214 CACTGTGCACCACCCCAGCCTGG - Intronic
1029173148 7:98644843-98644865 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1029361914 7:100094066-100094088 CCTCCCGCTCCAGCCCTGCCGGG - Intronic
1029414855 7:100436248-100436270 CCCAGTGCCCGAGCCCGGCCTGG - Exonic
1029487268 7:100851064-100851086 CCAAGAGCTCCAGACCAGCCTGG - Intronic
1029528878 7:101112264-101112286 CCCAGCACTCCAGCCCTGCCTGG + Intergenic
1029557324 7:101279401-101279423 CCAGGTGTTCCAGACCAGCCTGG + Intergenic
1031197042 7:118628223-118628245 CCAAGAGCTCCAGACCAGCCTGG + Intergenic
1031513080 7:122672658-122672680 CCCATTCCTCCACCCCAGCCTGG + Intronic
1031736208 7:125365256-125365278 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1032194540 7:129781446-129781468 CCCCCAGCTCCTGCCGAGCCGGG + Intergenic
1032591195 7:133193909-133193931 CCCCATGCTTCAGTCCATCCTGG + Intergenic
1033220404 7:139523669-139523691 CCTCGCGCTCCTCCCCAGCCCGG + Intergenic
1033308412 7:140241479-140241501 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1033589447 7:142797396-142797418 CCCCGAGCTCCTGCCCACCCTGG - Intergenic
1034179369 7:149126038-149126060 GCACCTTCTCCAGCCCAGCCCGG + Intronic
1034243573 7:149627312-149627334 CCCCGAGTTTCAGACCAGCCTGG + Intergenic
1034291625 7:149936997-149937019 CCAGGAGTTCCAGCCCAGCCTGG - Intergenic
1034320979 7:150181553-150181575 CACTGCACTCCAGCCCAGCCTGG + Intergenic
1034339139 7:150341080-150341102 CCCCGAGGTCCAGGCCAGCCGGG + Exonic
1034771767 7:153785684-153785706 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1034814463 7:154159897-154159919 CCAGGAGTTCCAGCCCAGCCTGG + Intronic
1035168054 7:157003245-157003267 CCCCGTCCTCCAGCAGAGCCAGG - Intronic
1035266044 7:157690846-157690868 CCGCGTGCTCCGCCCCGGCCCGG + Intronic
1035657447 8:1320553-1320575 CCCTGTGCTTGAGCTCAGCCTGG + Intergenic
1038297519 8:26309068-26309090 CCATGAGCTCAAGCCCAGCCTGG - Intronic
1038350339 8:26770454-26770476 CACCCTGCACCCGCCCAGCCAGG - Exonic
1038455907 8:27671870-27671892 CCCTCTCCTCCTGCCCAGCCAGG - Exonic
1038547647 8:28438104-28438126 CCCGGAGCTCGAGACCAGCCTGG + Intronic
1038595753 8:28884392-28884414 CCAGGTGTTCCAGACCAGCCTGG - Intronic
1038736155 8:30171465-30171487 CCACGAGTTCCAGACCAGCCAGG - Intronic
1038761204 8:30385047-30385069 CCCCGCGCCCCAGCCCTGCCCGG + Exonic
1039314647 8:36357649-36357671 CCCCGTTCTCCATCCAATCCAGG + Intergenic
1040076945 8:43246565-43246587 CCCGGTGCTGCGGCCAAGCCAGG + Intergenic
1040385252 8:46910981-46911003 CCCACTGCCCCACCCCAGCCTGG + Intergenic
1041350370 8:56942252-56942274 CCAAGTGCTCAAGACCAGCCTGG + Intergenic
1041390255 8:57341468-57341490 CCACTTCCTCCATCCCAGCCAGG + Intergenic
1041720509 8:60971286-60971308 CCAGGAGCTCCAGGCCAGCCTGG - Intergenic
1041834470 8:62196228-62196250 GCCTGTGCTCCTGCACAGCCTGG - Intergenic
1044735636 8:95275401-95275423 CACCGTACTCCACTCCAGCCTGG + Intergenic
1044839778 8:96327787-96327809 CCCCGTGGTCCTGGACAGCCTGG + Intronic
1045081500 8:98630430-98630452 CCACGTGTTCGAGACCAGCCTGG + Intronic
1046170655 8:110500981-110501003 CCAGGTGTTCCAGACCAGCCTGG - Intergenic
1046633826 8:116649982-116650004 CCCTGTGCTCTAGCCATGCCAGG - Intronic
1046966668 8:120174904-120174926 GCCCCTGCTCCACCCCAACCAGG + Intronic
1047078719 8:121435616-121435638 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1047234105 8:123023906-123023928 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1047521538 8:125598883-125598905 ACCCTTGCTCCAGCCATGCCAGG + Intergenic
1047863201 8:128991652-128991674 CCCCTTGCTCAAGCCCTCCCAGG - Intergenic
1048462677 8:134635559-134635581 CCCCCTGCTCCGGCACAGCTAGG - Intronic
1048847680 8:138615958-138615980 CCCCCAGCCCCAGCCCAGCCAGG + Intronic
1049110511 8:140639572-140639594 CCACGAGTTCCAGACCAGCCTGG + Intergenic
1049207560 8:141370560-141370582 CCCTGGGTTCAAGCCCAGCCTGG + Intergenic
1049230328 8:141478457-141478479 CCCCATGCCCCACCCCACCCTGG - Intergenic
1049383667 8:142330288-142330310 CCCCGCTCCCCAGCCCAGCCAGG + Intronic
1049564999 8:143333591-143333613 CCCAGTGGTGCAGCCCTGCCTGG - Intronic
1049580489 8:143408504-143408526 CCCCGGTCTCCATCCCAGCCAGG - Intergenic
1049730210 8:144173463-144173485 CATTGTACTCCAGCCCAGCCTGG - Intronic
1051556699 9:18391852-18391874 CCTCGCTCTGCAGCCCAGCCTGG + Intergenic
1051800831 9:20931857-20931879 CACTGCACTCCAGCCCAGCCTGG + Intronic
1052997879 9:34560929-34560951 CCGGGGGCTCCAGCCCAGGCAGG - Intronic
1053081335 9:35179750-35179772 CACTGTGCCCTAGCCCAGCCTGG + Intronic
1053201623 9:36155861-36155883 CCAGGAGCTCCAGACCAGCCTGG + Intronic
1053387446 9:37705504-37705526 CCCAGAGCTCAAGACCAGCCTGG - Intronic
1053413227 9:37929026-37929048 CCCCCCTCTCCAGCCCTGCCTGG - Intronic
1053722855 9:40965299-40965321 CCAGGAGCTCCAGACCAGCCTGG - Intergenic
1054337374 9:63818334-63818356 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1054343113 9:63886700-63886722 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1056146631 9:83737617-83737639 CCCGGAGTTCCAGACCAGCCTGG - Intergenic
1056163348 9:83920020-83920042 CCACGAGTTCCAGACCAGCCTGG + Intronic
1056748649 9:89328013-89328035 CCACGAGTTCCAGACCAGCCTGG - Intronic
1057198543 9:93128301-93128323 CCCCAGGCCCCAGCACAGCCAGG + Intronic
1057631137 9:96719941-96719963 CCCAGCGCTGGAGCCCAGCCCGG + Intergenic
1057837175 9:98454785-98454807 CTCCATCCTGCAGCCCAGCCAGG + Intronic
1057840336 9:98481140-98481162 CCCCCAACCCCAGCCCAGCCTGG + Intronic
1057861676 9:98645635-98645657 CCCCATTCTCCAGCCCTGCCTGG + Intronic
1058027792 9:100161318-100161340 CACTGCACTCCAGCCCAGCCTGG + Intronic
1059102475 9:111483819-111483841 CCCCGTGCGCCAGGCCCGCGCGG + Intronic
1059250925 9:112887437-112887459 CTCCTTGCTGTAGCCCAGCCTGG + Intronic
1060530307 9:124343822-124343844 CCCCAAGCCCCAGCACAGCCCGG + Intronic
1060830698 9:126713596-126713618 CCAGGGGCTCCAGACCAGCCTGG - Intergenic
1061145411 9:128795092-128795114 CACTGTACTCCAGTCCAGCCTGG - Intronic
1061210978 9:129193158-129193180 CCCCAAGTTCCAGCCCAGCCAGG + Intergenic
1061215048 9:129216862-129216884 CACTGCACTCCAGCCCAGCCTGG - Intergenic
1061330676 9:129890359-129890381 CCCTGCCCTCCCGCCCAGCCCGG - Exonic
1061400506 9:130365739-130365761 CCCCCTCCCCCTGCCCAGCCTGG - Intronic
1061427629 9:130509863-130509885 CCAGGTGCTCAAGACCAGCCTGG + Intergenic
1061629531 9:131863395-131863417 GCCAGTGCTCCAGCCTGGCCAGG - Intronic
1061807507 9:133144564-133144586 TCCCGTGCGGCCGCCCAGCCCGG - Intronic
1062043381 9:134414359-134414381 CCCCACGCGCCAGCCCGGCCCGG - Intronic
1062070594 9:134553198-134553220 CCCGGGGCTCCAGCTCAGCCTGG + Intergenic
1062174097 9:135151415-135151437 CCCCGAGCTCTAGACCTGCCTGG + Intergenic
1062192905 9:135256870-135256892 CCCTACGCCCCAGCCCAGCCTGG + Intergenic
1062232697 9:135490978-135491000 CCCCGTGCTCCAGGGAAGACTGG - Intergenic
1062290553 9:135792490-135792512 CCCCACCCTCCAGCACAGCCTGG - Exonic
1062294388 9:135816369-135816391 ACCTGTGCTGCTGCCCAGCCAGG + Intronic
1062376144 9:136262741-136262763 CCCTCTCCTGCAGCCCAGCCTGG + Intergenic
1062412986 9:136434116-136434138 CCAGGAGCTCCCGCCCAGCCTGG - Exonic
1062446421 9:136597255-136597277 CACCTGGCCCCAGCCCAGCCTGG + Intergenic
1062574667 9:137200598-137200620 CCCCGCGCCCCCGCCCAGCGCGG + Exonic
1062613124 9:137383834-137383856 CCCCTCCCTCCAGCCCCGCCTGG + Intronic
1203740062 Un_GL000216v2:171107-171129 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1203452307 Un_GL000219v1:130678-130700 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1203364081 Un_KI270442v1:242760-242782 CCCACCGCTCCAGCCTAGCCAGG + Intergenic
1203364844 Un_KI270442v1:248210-248232 CCCTCTGCTGCACCCCAGCCAGG + Intergenic
1203377272 Un_KI270442v1:385643-385665 CCCCCTGCTCCAGCCCAGCCAGG - Intergenic
1185477136 X:422040-422062 CCCCCTGCCCCACCCCAACCCGG - Intergenic
1186163731 X:6805055-6805077 CCAGGAGCTCCAGACCAGCCTGG + Intergenic
1186611006 X:11138805-11138827 CCCCGCCCTCCAGCCCAGGGGGG - Exonic
1186829962 X:13380113-13380135 CACTGCTCTCCAGCCCAGCCTGG + Intergenic
1188320865 X:28735566-28735588 CCCGGAGTTCAAGCCCAGCCTGG + Intronic
1189334194 X:40160468-40160490 CGCTGCACTCCAGCCCAGCCTGG - Intronic
1189446662 X:41086266-41086288 GCCCGCGCGCCCGCCCAGCCCGG - Intronic
1189496935 X:41517099-41517121 CCCTGTGCTCCAGGCAGGCCTGG - Intronic
1189649860 X:43177469-43177491 CCATGTGCTCCAGCCCCACCTGG - Intergenic
1189988478 X:46574066-46574088 CCCCGGCCTGCAGCGCAGCCTGG + Exonic
1190528733 X:51353710-51353732 CCCCATGCTCCAAGCCAGCCTGG - Intergenic
1190534944 X:51417012-51417034 TCCCATGCCCCATCCCAGCCAGG - Intergenic
1190878135 X:54474410-54474432 CCCCTGGCTACATCCCAGCCAGG + Intronic
1190940864 X:55039807-55039829 CCCCGGGCTGAATCCCAGCCTGG - Intergenic
1193360401 X:80573413-80573435 CCCCGTGCTGCAGCGCATCAAGG - Intergenic
1193381231 X:80818640-80818662 CACCGTACTCCACTCCAGCCTGG + Intergenic
1195056770 X:101153494-101153516 CCAGGAGCTCCAGACCAGCCTGG - Intronic
1196390994 X:115207327-115207349 CCAGGTGTTCCAGACCAGCCTGG + Intronic
1198369512 X:135976389-135976411 CCCCTTCTTCCAGACCAGCCTGG + Intergenic
1198740129 X:139833470-139833492 CCCAGAGTTCCAGACCAGCCTGG + Intronic
1199273915 X:145920727-145920749 ACCCTTGCCCCAGCCCAGGCAGG + Intergenic
1200087726 X:153617251-153617273 CCACGAGCTCAAGACCAGCCTGG - Intergenic
1200088681 X:153624377-153624399 CCCGGTGGCCCAGCCCAGCCCGG - Intergenic
1200151956 X:153955521-153955543 GCCCGTGTCCCAGCCCACCCAGG - Exonic
1200396878 X:155996066-155996088 CACTGCACTCCAGCCCAGCCTGG + Intergenic
1201073890 Y:10172276-10172298 CCCTCTGCTGCAGCCCAGCCAGG - Intergenic
1201175743 Y:11307561-11307583 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1201177007 Y:11315565-11315587 CCCTGTACTGCAGCCCAGCCGGG + Intergenic
1201178129 Y:11322202-11322224 CCCCGTGCTCCAGTCCAGCTTGG + Intergenic
1201179709 Y:11332975-11332997 CCCCGTGCTCCAGCCCAGCCAGG + Intergenic
1202242269 Y:22783554-22783576 CCAGGTGTTCCAGGCCAGCCTGG + Intergenic
1202395253 Y:24417302-24417324 CCAGGTGTTCCAGGCCAGCCTGG + Intergenic
1202475532 Y:25252792-25252814 CCAGGTGTTCCAGGCCAGCCTGG - Intergenic