ID: 1203740533

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000216v2:173583-173605
Sequence CTTGTCAAGGCTATGCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203740533_1203740539 7 Left 1203740533 Un_GL000216v2:173583-173605 CCTGTAAGCATAGCCTTGACAAG No data
Right 1203740539 Un_GL000216v2:173613-173635 TCTCCTGGGTGATCATTGCAGGG No data
1203740533_1203740537 -7 Left 1203740533 Un_GL000216v2:173583-173605 CCTGTAAGCATAGCCTTGACAAG No data
Right 1203740537 Un_GL000216v2:173599-173621 TGACAAGTGGTATATCTCCTGGG No data
1203740533_1203740538 6 Left 1203740533 Un_GL000216v2:173583-173605 CCTGTAAGCATAGCCTTGACAAG No data
Right 1203740538 Un_GL000216v2:173612-173634 ATCTCCTGGGTGATCATTGCAGG No data
1203740533_1203740536 -8 Left 1203740533 Un_GL000216v2:173583-173605 CCTGTAAGCATAGCCTTGACAAG No data
Right 1203740536 Un_GL000216v2:173598-173620 TTGACAAGTGGTATATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203740533 Original CRISPR CTTGTCAAGGCTATGCTTAC AGG (reversed) Intergenic
No off target data available for this crispr