ID: 1203743008

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000218v1:18676-18698
Sequence GTGTACACCCCCTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203743005_1203743008 9 Left 1203743005 Un_GL000218v1:18644-18666 CCCATGGATATAGGAACAGTATC No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203742998_1203743008 25 Left 1203742998 Un_GL000218v1:18628-18650 CCCAATATCCTTTTCCCCCATGG No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203743002_1203743008 17 Left 1203743002 Un_GL000218v1:18636-18658 CCTTTTCCCCCATGGATATAGGA No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203743000_1203743008 24 Left 1203743000 Un_GL000218v1:18629-18651 CCAATATCCTTTTCCCCCATGGA No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203743006_1203743008 8 Left 1203743006 Un_GL000218v1:18645-18667 CCATGGATATAGGAACAGTATCA No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203743003_1203743008 11 Left 1203743003 Un_GL000218v1:18642-18664 CCCCCATGGATATAGGAACAGTA No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data
1203743004_1203743008 10 Left 1203743004 Un_GL000218v1:18643-18665 CCCCATGGATATAGGAACAGTAT No data
Right 1203743008 Un_GL000218v1:18676-18698 GTGTACACCCCCTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203743008 Original CRISPR GTGTACACCCCCTGCCATAT TGG Intergenic
No off target data available for this crispr