ID: 1203759349

View in Genome Browser
Species Human (GRCh38)
Location EBV:3998-4020
Sequence GCCGAGTTGTCTGCCCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759349_1203759355 0 Left 1203759349 EBV:3998-4020 CCGCGCCGGGCAGACAACTCGGC No data
Right 1203759355 EBV:4021-4043 CGTGATGGAGGCTATGACGGCGG No data
1203759349_1203759356 19 Left 1203759349 EBV:3998-4020 CCGCGCCGGGCAGACAACTCGGC No data
Right 1203759356 EBV:4040-4062 GCGGCGAGTGACTACGCGCGTGG No data
1203759349_1203759353 -3 Left 1203759349 EBV:3998-4020 CCGCGCCGGGCAGACAACTCGGC No data
Right 1203759353 EBV:4018-4040 GGCCGTGATGGAGGCTATGACGG No data
1203759349_1203759357 24 Left 1203759349 EBV:3998-4020 CCGCGCCGGGCAGACAACTCGGC No data
Right 1203759357 EBV:4045-4067 GAGTGACTACGCGCGTGGCCTGG No data
1203759349_1203759358 25 Left 1203759349 EBV:3998-4020 CCGCGCCGGGCAGACAACTCGGC No data
Right 1203759358 EBV:4046-4068 AGTGACTACGCGCGTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759349 Original CRISPR GCCGAGTTGTCTGCCCGGCG CGG (reversed) Intergenic
No off target data available for this crispr