ID: 1203759661

View in Genome Browser
Species Human (GRCh38)
Location EBV:5596-5618
Sequence CCGTGGGGTGCCCAAAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759661_1203759676 21 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759661_1203759668 -9 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759668 EBV:5610-5632 ACCCCACGGGGTGCTCCCCCTGG No data
1203759661_1203759677 30 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759661 Original CRISPR CCGTGGGGTGCCCAAAGGCG GGG (reversed) Intergenic