ID: 1203759667

View in Genome Browser
Species Human (GRCh38)
Location EBV:5601-5623
Sequence GCACCCCGTGGGGTGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759667_1203759677 25 Left 1203759667 EBV:5601-5623 CCTTTGGGCACCCCACGGGGTGC No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759667_1203759678 30 Left 1203759667 EBV:5601-5623 CCTTTGGGCACCCCACGGGGTGC No data
Right 1203759678 EBV:5654-5676 CACCTATGGTCACTCAGGCACGG No data
1203759667_1203759676 16 Left 1203759667 EBV:5601-5623 CCTTTGGGCACCCCACGGGGTGC No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759667 Original CRISPR GCACCCCGTGGGGTGCCCAA AGG (reversed) Intergenic