ID: 1203759668

View in Genome Browser
Species Human (GRCh38)
Location EBV:5610-5632
Sequence ACCCCACGGGGTGCTCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759663_1203759668 -10 Left 1203759663 EBV:5597-5619 CCCGCCTTTGGGCACCCCACGGG No data
Right 1203759668 EBV:5610-5632 ACCCCACGGGGTGCTCCCCCTGG No data
1203759661_1203759668 -9 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759668 EBV:5610-5632 ACCCCACGGGGTGCTCCCCCTGG No data
1203759660_1203759668 -8 Left 1203759660 EBV:5595-5617 CCCCCGCCTTTGGGCACCCCACG No data
Right 1203759668 EBV:5610-5632 ACCCCACGGGGTGCTCCCCCTGG No data
1203759659_1203759668 -7 Left 1203759659 EBV:5594-5616 CCCCCCGCCTTTGGGCACCCCAC No data
Right 1203759668 EBV:5610-5632 ACCCCACGGGGTGCTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759668 Original CRISPR ACCCCACGGGGTGCTCCCCC TGG Intergenic
No off target data available for this crispr