ID: 1203759671

View in Genome Browser
Species Human (GRCh38)
Location EBV:5613-5635
Sequence TGTCCAGGGGGAGCACCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759671_1203759678 18 Left 1203759671 EBV:5613-5635 CCACGGGGTGCTCCCCCTGGACA No data
Right 1203759678 EBV:5654-5676 CACCTATGGTCACTCAGGCACGG No data
1203759671_1203759676 4 Left 1203759671 EBV:5613-5635 CCACGGGGTGCTCCCCCTGGACA No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759671_1203759677 13 Left 1203759671 EBV:5613-5635 CCACGGGGTGCTCCCCCTGGACA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759671 Original CRISPR TGTCCAGGGGGAGCACCCCG TGG (reversed) Intergenic