ID: 1203759672

View in Genome Browser
Species Human (GRCh38)
Location EBV:5625-5647
Sequence TTGAAACATAAGTGTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759672_1203759678 6 Left 1203759672 EBV:5625-5647 CCCCCTGGACACTTATGTTTCAA No data
Right 1203759678 EBV:5654-5676 CACCTATGGTCACTCAGGCACGG No data
1203759672_1203759676 -8 Left 1203759672 EBV:5625-5647 CCCCCTGGACACTTATGTTTCAA No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759672_1203759677 1 Left 1203759672 EBV:5625-5647 CCCCCTGGACACTTATGTTTCAA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759672 Original CRISPR TTGAAACATAAGTGTCCAGG GGG (reversed) Intergenic
No off target data available for this crispr