ID: 1203759675

View in Genome Browser
Species Human (GRCh38)
Location EBV:5628-5650
Sequence TGCTTGAAACATAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759675_1203759678 3 Left 1203759675 EBV:5628-5650 CCTGGACACTTATGTTTCAAGCA No data
Right 1203759678 EBV:5654-5676 CACCTATGGTCACTCAGGCACGG No data
1203759675_1203759677 -2 Left 1203759675 EBV:5628-5650 CCTGGACACTTATGTTTCAAGCA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759675 Original CRISPR TGCTTGAAACATAAGTGTCC AGG (reversed) Intergenic