ID: 1203759676

View in Genome Browser
Species Human (GRCh38)
Location EBV:5640-5662
Sequence TGTTTCAAGCAGCTCACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759673_1203759676 -9 Left 1203759673 EBV:5626-5648 CCCCTGGACACTTATGTTTCAAG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759671_1203759676 4 Left 1203759671 EBV:5613-5635 CCACGGGGTGCTCCCCCTGGACA No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759663_1203759676 20 Left 1203759663 EBV:5597-5619 CCCGCCTTTGGGCACCCCACGGG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759667_1203759676 16 Left 1203759667 EBV:5601-5623 CCTTTGGGCACCCCACGGGGTGC No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759665_1203759676 19 Left 1203759665 EBV:5598-5620 CCGCCTTTGGGCACCCCACGGGG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759661_1203759676 21 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759672_1203759676 -8 Left 1203759672 EBV:5625-5647 CCCCCTGGACACTTATGTTTCAA No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759670_1203759676 5 Left 1203759670 EBV:5612-5634 CCCACGGGGTGCTCCCCCTGGAC No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759660_1203759676 22 Left 1203759660 EBV:5595-5617 CCCCCGCCTTTGGGCACCCCACG No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759669_1203759676 6 Left 1203759669 EBV:5611-5633 CCCCACGGGGTGCTCCCCCTGGA No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759659_1203759676 23 Left 1203759659 EBV:5594-5616 CCCCCCGCCTTTGGGCACCCCAC No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data
1203759674_1203759676 -10 Left 1203759674 EBV:5627-5649 CCCTGGACACTTATGTTTCAAGC No data
Right 1203759676 EBV:5640-5662 TGTTTCAAGCAGCTCACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759676 Original CRISPR TGTTTCAAGCAGCTCACCTA TGG Intergenic
No off target data available for this crispr