ID: 1203759677

View in Genome Browser
Species Human (GRCh38)
Location EBV:5649-5671
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759670_1203759677 14 Left 1203759670 EBV:5612-5634 CCCACGGGGTGCTCCCCCTGGAC No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759671_1203759677 13 Left 1203759671 EBV:5613-5635 CCACGGGGTGCTCCCCCTGGACA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759661_1203759677 30 Left 1203759661 EBV:5596-5618 CCCCGCCTTTGGGCACCCCACGG No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759672_1203759677 1 Left 1203759672 EBV:5625-5647 CCCCCTGGACACTTATGTTTCAA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759665_1203759677 28 Left 1203759665 EBV:5598-5620 CCGCCTTTGGGCACCCCACGGGG No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759674_1203759677 -1 Left 1203759674 EBV:5627-5649 CCCTGGACACTTATGTTTCAAGC No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759673_1203759677 0 Left 1203759673 EBV:5626-5648 CCCCTGGACACTTATGTTTCAAG No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759669_1203759677 15 Left 1203759669 EBV:5611-5633 CCCCACGGGGTGCTCCCCCTGGA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759667_1203759677 25 Left 1203759667 EBV:5601-5623 CCTTTGGGCACCCCACGGGGTGC No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759675_1203759677 -2 Left 1203759675 EBV:5628-5650 CCTGGACACTTATGTTTCAAGCA No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data
1203759663_1203759677 29 Left 1203759663 EBV:5597-5619 CCCGCCTTTGGGCACCCCACGGG No data
Right 1203759677 EBV:5649-5671 CAGCTCACCTATGGTCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759677 Original CRISPR CAGCTCACCTATGGTCACTC AGG Intergenic