ID: 1203759739 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | EBV:6005-6027 |
Sequence | TCCAGATGGGTGTATTGTCC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203759739_1203759743 | -4 | Left | 1203759739 | EBV:6005-6027 | CCCGGACAATACACCCATCTGGA | No data | ||
Right | 1203759743 | EBV:6024-6046 | TGGAGTTCAACCTAATTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203759739 | Original CRISPR | TCCAGATGGGTGTATTGTCC GGG (reversed) | Intergenic | ||