ID: 1203759740

View in Genome Browser
Species Human (GRCh38)
Location EBV:6006-6028
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203759740_1203759743 -5 Left 1203759740 EBV:6006-6028 CCGGACAATACACCCATCTGGAG No data
Right 1203759743 EBV:6024-6046 TGGAGTTCAACCTAATTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203759740 Original CRISPR CTCCAGATGGGTGTATTGTC CGG (reversed) Intergenic