ID: 1203761551

View in Genome Browser
Species Human (GRCh38)
Location EBV:14966-14988
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203761551_1203761573 26 Left 1203761551 EBV:14966-14988 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203761573 EBV:15015-15037 CCTCCAGAGACCCGGGCTTCAGG No data
1203761551_1203761568 19 Left 1203761551 EBV:14966-14988 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203761568 EBV:15008-15030 TCCCCGTCCTCCAGAGACCCGGG No data
1203761551_1203761567 18 Left 1203761551 EBV:14966-14988 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203761567 EBV:15007-15029 GTCCCCGTCCTCCAGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203761551 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr