ID: 1203762480

View in Genome Browser
Species Human (GRCh38)
Location EBV:18038-18060
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203762480_1203762497 19 Left 1203762480 EBV:18038-18060 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203762497 EBV:18080-18102 TCCCCGTCCTCCAGAGACCCGGG No data
1203762480_1203762502 26 Left 1203762480 EBV:18038-18060 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203762502 EBV:18087-18109 CCTCCAGAGACCCGGGCTTCAGG No data
1203762480_1203762496 18 Left 1203762480 EBV:18038-18060 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203762496 EBV:18079-18101 GTCCCCGTCCTCCAGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203762480 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr