ID: 1203763168

View in Genome Browser
Species Human (GRCh38)
Location EBV:20013-20035
Sequence TGGGGGCTTCTGGGGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203763168_1203763181 15 Left 1203763168 EBV:20013-20035 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203763181 EBV:20051-20073 GCCATGCGCGCCCTGTCACCAGG No data
1203763168_1203763176 -7 Left 1203763168 EBV:20013-20035 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203763176 EBV:20029-20051 GCCCCCAAAAGTAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203763168 Original CRISPR TGGGGGCTTCTGGGGGGACC GGG (reversed) Intergenic
No off target data available for this crispr