ID: 1203763409

View in Genome Browser
Species Human (GRCh38)
Location EBV:21110-21132
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203763409_1203763426 19 Left 1203763409 EBV:21110-21132 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203763426 EBV:21152-21174 TCCCCGTCCTCCAGAGACCCGGG No data
1203763409_1203763425 18 Left 1203763409 EBV:21110-21132 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203763425 EBV:21151-21173 GTCCCCGTCCTCCAGAGACCCGG No data
1203763409_1203763431 26 Left 1203763409 EBV:21110-21132 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203763431 EBV:21159-21181 CCTCCAGAGACCCGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203763409 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr