ID: 1203764338

View in Genome Browser
Species Human (GRCh38)
Location EBV:24182-24204
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203764338_1203764354 18 Left 1203764338 EBV:24182-24204 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203764354 EBV:24223-24245 GTCCCCGTCCTCCAGAGACCCGG No data
1203764338_1203764355 19 Left 1203764338 EBV:24182-24204 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203764355 EBV:24224-24246 TCCCCGTCCTCCAGAGACCCGGG No data
1203764338_1203764360 26 Left 1203764338 EBV:24182-24204 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203764360 EBV:24231-24253 CCTCCAGAGACCCGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203764338 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr