ID: 1203765026

View in Genome Browser
Species Human (GRCh38)
Location EBV:26157-26179
Sequence TGGGGGCTTCTGGGGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203765026_1203765039 15 Left 1203765026 EBV:26157-26179 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203765039 EBV:26195-26217 GCCATGCGCGCCCTGTCACCAGG No data
1203765026_1203765034 -7 Left 1203765026 EBV:26157-26179 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203765034 EBV:26173-26195 GCCCCCAAAAGTAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203765026 Original CRISPR TGGGGGCTTCTGGGGGGACC GGG (reversed) Intergenic
No off target data available for this crispr