ID: 1203765267

View in Genome Browser
Species Human (GRCh38)
Location EBV:27254-27276
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203765267_1203765283 18 Left 1203765267 EBV:27254-27276 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203765283 EBV:27295-27317 GTCCCCGTCCTCCAGAGACCCGG No data
1203765267_1203765284 19 Left 1203765267 EBV:27254-27276 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203765284 EBV:27296-27318 TCCCCGTCCTCCAGAGACCCGGG No data
1203765267_1203765289 26 Left 1203765267 EBV:27254-27276 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203765289 EBV:27303-27325 CCTCCAGAGACCCGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203765267 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr