ID: 1203765955

View in Genome Browser
Species Human (GRCh38)
Location EBV:29229-29251
Sequence TGGGGGCTTCTGGGGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203765955_1203765968 15 Left 1203765955 EBV:29229-29251 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203765968 EBV:29267-29289 GCCATGCGCGCCCTGTCACCAGG No data
1203765955_1203765963 -7 Left 1203765955 EBV:29229-29251 CCCGGTCCCCCCAGAAGCCCCCA No data
Right 1203765963 EBV:29245-29267 GCCCCCAAAAGTAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203765955 Original CRISPR TGGGGGCTTCTGGGGGGACC GGG (reversed) Intergenic
No off target data available for this crispr