ID: 1203766196

View in Genome Browser
Species Human (GRCh38)
Location EBV:30326-30348
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203766196_1203766212 18 Left 1203766196 EBV:30326-30348 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203766212 EBV:30367-30389 GTCCCCGTCCTCCAGAGACCCGG No data
1203766196_1203766218 26 Left 1203766196 EBV:30326-30348 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203766218 EBV:30375-30397 CCTCCAGAGACCCGGGCTTCAGG No data
1203766196_1203766213 19 Left 1203766196 EBV:30326-30348 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203766213 EBV:30368-30390 TCCCCGTCCTCCAGAGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203766196 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr