ID: 1203767125

View in Genome Browser
Species Human (GRCh38)
Location EBV:33398-33420
Sequence GGGGACTAGGGAACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203767125_1203767142 19 Left 1203767125 EBV:33398-33420 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203767142 EBV:33440-33462 TCCCCGTCCTCCAGAGACCCGGG No data
1203767125_1203767141 18 Left 1203767125 EBV:33398-33420 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203767141 EBV:33439-33461 GTCCCCGTCCTCCAGAGACCCGG No data
1203767125_1203767147 26 Left 1203767125 EBV:33398-33420 CCCTCCTCAGTTCCCTAGTCCCC No data
Right 1203767147 EBV:33447-33469 CCTCCAGAGACCCGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203767125 Original CRISPR GGGGACTAGGGAACTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr