ID: 1203770313

View in Genome Browser
Species Human (GRCh38)
Location EBV:46738-46760
Sequence TGCACCGTGAAGCTGCGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203770303_1203770313 18 Left 1203770303 EBV:46697-46719 CCGGGGCGCATGTGTTCTCCAGG No data
Right 1203770313 EBV:46738-46760 TGCACCGTGAAGCTGCGCCACGG No data
1203770307_1203770313 0 Left 1203770307 EBV:46715-46737 CCAGGGGCAGCTCCCAACCCCTC No data
Right 1203770313 EBV:46738-46760 TGCACCGTGAAGCTGCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203770313 Original CRISPR TGCACCGTGAAGCTGCGCCA CGG Intergenic
No off target data available for this crispr