ID: 1203770514

View in Genome Browser
Species Human (GRCh38)
Location EBV:47746-47768
Sequence GAAAAGCGAGCCTGGCGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203770514_1203770524 19 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770524 EBV:47788-47810 ACTGGTTGTCGGAGGTGGAGAGG No data
1203770514_1203770525 24 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770525 EBV:47793-47815 TTGTCGGAGGTGGAGAGGCCCGG No data
1203770514_1203770527 26 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770527 EBV:47795-47817 GTCGGAGGTGGAGAGGCCCGGGG No data
1203770514_1203770526 25 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770526 EBV:47794-47816 TGTCGGAGGTGGAGAGGCCCGGG No data
1203770514_1203770522 14 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770522 EBV:47783-47805 CGCCTACTGGTTGTCGGAGGTGG No data
1203770514_1203770517 1 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770517 EBV:47770-47792 GAAGCCACTCGTCCGCCTACTGG No data
1203770514_1203770528 27 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770528 EBV:47796-47818 TCGGAGGTGGAGAGGCCCGGGGG No data
1203770514_1203770520 11 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770520 EBV:47780-47802 GTCCGCCTACTGGTTGTCGGAGG No data
1203770514_1203770519 8 Left 1203770514 EBV:47746-47768 CCTCTACGCCAGGCTCGCTTTTC No data
Right 1203770519 EBV:47777-47799 CTCGTCCGCCTACTGGTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203770514 Original CRISPR GAAAAGCGAGCCTGGCGTAG AGG (reversed) Intergenic
No off target data available for this crispr