ID: 1203771131

View in Genome Browser
Species Human (GRCh38)
Location EBV:50634-50656
Sequence AAGCCGGACGGCGCTTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203771123_1203771131 5 Left 1203771123 EBV:50606-50628 CCCCAGGGCGGGTGCCTGGGGGA No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771124_1203771131 4 Left 1203771124 EBV:50607-50629 CCCAGGGCGGGTGCCTGGGGGAT No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771117_1203771131 15 Left 1203771117 EBV:50596-50618 CCAAGCCGGACCCCAGGGCGGGT No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771118_1203771131 10 Left 1203771118 EBV:50601-50623 CCGGACCCCAGGGCGGGTGCCTG No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771129_1203771131 -9 Left 1203771129 EBV:50620-50642 CCTGGGGGATGGGAAAGCCGGAC No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771125_1203771131 3 Left 1203771125 EBV:50608-50630 CCAGGGCGGGTGCCTGGGGGATG No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data
1203771112_1203771131 24 Left 1203771112 EBV:50587-50609 CCGGGGCGGCCAAGCCGGACCCC No data
Right 1203771131 EBV:50634-50656 AAGCCGGACGGCGCTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203771131 Original CRISPR AAGCCGGACGGCGCTTCTCC CGG Intergenic