ID: 1203771974

View in Genome Browser
Species Human (GRCh38)
Location EBV:54100-54122
Sequence GGCCGAGGCGGCCGAGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203771974_1203771981 11 Left 1203771974 EBV:54100-54122 CCCGGACCTCGGCCGCCTCGGCC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771974_1203771984 19 Left 1203771974 EBV:54100-54122 CCCGGACCTCGGCCGCCTCGGCC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771974_1203771983 16 Left 1203771974 EBV:54100-54122 CCCGGACCTCGGCCGCCTCGGCC No data
Right 1203771983 EBV:54139-54161 AGAAGAAGTCCCCCGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203771974 Original CRISPR GGCCGAGGCGGCCGAGGTCC GGG (reversed) Intergenic
No off target data available for this crispr