ID: 1203771981

View in Genome Browser
Species Human (GRCh38)
Location EBV:54134-54156
Sequence CTCCGAGAAGAAGTCCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203771979_1203771981 -4 Left 1203771979 EBV:54115-54137 CCTCGGCCTCGGTCAGCAGCTCC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771970_1203771981 26 Left 1203771970 EBV:54085-54107 CCTGCTCTTCCAGCGCCCGGACC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771972_1203771981 17 Left 1203771972 EBV:54094-54116 CCAGCGCCCGGACCTCGGCCGCC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771977_1203771981 5 Left 1203771977 EBV:54106-54128 CCTCGGCCGCCTCGGCCTCGGTC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771978_1203771981 -1 Left 1203771978 EBV:54112-54134 CCGCCTCGGCCTCGGTCAGCAGC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771975_1203771981 10 Left 1203771975 EBV:54101-54123 CCGGACCTCGGCCGCCTCGGCCT No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771980_1203771981 -10 Left 1203771980 EBV:54121-54143 CCTCGGTCAGCAGCTCCGAGAAG No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data
1203771974_1203771981 11 Left 1203771974 EBV:54100-54122 CCCGGACCTCGGCCGCCTCGGCC No data
Right 1203771981 EBV:54134-54156 CTCCGAGAAGAAGTCCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203771981 Original CRISPR CTCCGAGAAGAAGTCCCCCG TGG Intergenic