ID: 1203771984

View in Genome Browser
Species Human (GRCh38)
Location EBV:54142-54164
Sequence AGAAGTCCCCCGTGGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203771975_1203771984 18 Left 1203771975 EBV:54101-54123 CCGGACCTCGGCCGCCTCGGCCT No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771974_1203771984 19 Left 1203771974 EBV:54100-54122 CCCGGACCTCGGCCGCCTCGGCC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771980_1203771984 -2 Left 1203771980 EBV:54121-54143 CCTCGGTCAGCAGCTCCGAGAAG No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771979_1203771984 4 Left 1203771979 EBV:54115-54137 CCTCGGCCTCGGTCAGCAGCTCC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771972_1203771984 25 Left 1203771972 EBV:54094-54116 CCAGCGCCCGGACCTCGGCCGCC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771977_1203771984 13 Left 1203771977 EBV:54106-54128 CCTCGGCCGCCTCGGCCTCGGTC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data
1203771978_1203771984 7 Left 1203771978 EBV:54112-54134 CCGCCTCGGCCTCGGTCAGCAGC No data
Right 1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203771984 Original CRISPR AGAAGTCCCCCGTGGCCTGG AGG Intergenic