ID: 1203772860

View in Genome Browser
Species Human (GRCh38)
Location EBV:58219-58241
Sequence GTCTCCGGCCTCTGCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203772860_1203772868 3 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772868 EBV:58245-58267 GGCGGGGAGTTGGTCTTTGCAGG No data
1203772860_1203772867 -7 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772867 EBV:58235-58257 CGGAGACGACGGCGGGGAGTTGG No data
1203772860_1203772870 17 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772870 EBV:58259-58281 CTTTGCAGGACTATACCTGGCGG No data
1203772860_1203772872 22 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772872 EBV:58264-58286 CAGGACTATACCTGGCGGCAGGG No data
1203772860_1203772869 14 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772869 EBV:58256-58278 GGTCTTTGCAGGACTATACCTGG No data
1203772860_1203772871 21 Left 1203772860 EBV:58219-58241 CCGGGGCCGCAGAGGCCGGAGAC No data
Right 1203772871 EBV:58263-58285 GCAGGACTATACCTGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203772860 Original CRISPR GTCTCCGGCCTCTGCGGCCC CGG (reversed) Intergenic
No off target data available for this crispr