ID: 1203774463

View in Genome Browser
Species Human (GRCh38)
Location EBV:65043-65065
Sequence CTGTTTGACCCCAAGGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774459_1203774463 -5 Left 1203774459 EBV:65025-65047 CCCTGGTCGGACTGGTACCTGTT No data
Right 1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG No data
1203774451_1203774463 29 Left 1203774451 EBV:64991-65013 CCCCGAGCTCTTCTTCAAGCTTT No data
Right 1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG No data
1203774460_1203774463 -6 Left 1203774460 EBV:65026-65048 CCTGGTCGGACTGGTACCTGTTT No data
Right 1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG No data
1203774453_1203774463 27 Left 1203774453 EBV:64993-65015 CCGAGCTCTTCTTCAAGCTTTTT No data
Right 1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG No data
1203774452_1203774463 28 Left 1203774452 EBV:64992-65014 CCCGAGCTCTTCTTCAAGCTTTT No data
Right 1203774463 EBV:65043-65065 CTGTTTGACCCCAAGGACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774463 Original CRISPR CTGTTTGACCCCAAGGACGC CGG Intergenic
No off target data available for this crispr