ID: 1203774640 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | EBV:65914-65936 |
| Sequence | GTCCGAACAGCCCGTCACCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203774640_1203774646 | 14 | Left | 1203774640 | EBV:65914-65936 | CCCAGGTGACGGGCTGTTCGGAC | No data | ||
| Right | 1203774646 | EBV:65951-65973 | CTATGCCAATGCGTCCACCAAGG | No data | ||||
| 1203774640_1203774650 | 29 | Left | 1203774640 | EBV:65914-65936 | CCCAGGTGACGGGCTGTTCGGAC | No data | ||
| Right | 1203774650 | EBV:65966-65988 | CACCAAGGTCACCAACAAGGAGG | No data | ||||
| 1203774640_1203774648 | 26 | Left | 1203774640 | EBV:65914-65936 | CCCAGGTGACGGGCTGTTCGGAC | No data | ||
| Right | 1203774648 | EBV:65963-65985 | GTCCACCAAGGTCACCAACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203774640 | Original CRISPR | GTCCGAACAGCCCGTCACCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||