ID: 1203774640

View in Genome Browser
Species Human (GRCh38)
Location EBV:65914-65936
Sequence GTCCGAACAGCCCGTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774640_1203774650 29 Left 1203774640 EBV:65914-65936 CCCAGGTGACGGGCTGTTCGGAC No data
Right 1203774650 EBV:65966-65988 CACCAAGGTCACCAACAAGGAGG No data
1203774640_1203774646 14 Left 1203774640 EBV:65914-65936 CCCAGGTGACGGGCTGTTCGGAC No data
Right 1203774646 EBV:65951-65973 CTATGCCAATGCGTCCACCAAGG No data
1203774640_1203774648 26 Left 1203774640 EBV:65914-65936 CCCAGGTGACGGGCTGTTCGGAC No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774640 Original CRISPR GTCCGAACAGCCCGTCACCT GGG (reversed) Intergenic