ID: 1203774641

View in Genome Browser
Species Human (GRCh38)
Location EBV:65915-65937
Sequence CGTCCGAACAGCCCGTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774641_1203774650 28 Left 1203774641 EBV:65915-65937 CCAGGTGACGGGCTGTTCGGACG No data
Right 1203774650 EBV:65966-65988 CACCAAGGTCACCAACAAGGAGG No data
1203774641_1203774646 13 Left 1203774641 EBV:65915-65937 CCAGGTGACGGGCTGTTCGGACG No data
Right 1203774646 EBV:65951-65973 CTATGCCAATGCGTCCACCAAGG No data
1203774641_1203774648 25 Left 1203774641 EBV:65915-65937 CCAGGTGACGGGCTGTTCGGACG No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774641 Original CRISPR CGTCCGAACAGCCCGTCACC TGG (reversed) Intergenic
No off target data available for this crispr