ID: 1203774642

View in Genome Browser
Species Human (GRCh38)
Location EBV:65938-65960
Sequence ATTGGCATAGAAGGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774642_1203774648 2 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774642_1203774655 25 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774642_1203774652 8 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774652 EBV:65969-65991 CAAGGTCACCAACAAGGAGGAGG No data
1203774642_1203774654 16 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774642_1203774650 5 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774650 EBV:65966-65988 CACCAAGGTCACCAACAAGGAGG No data
1203774642_1203774646 -10 Left 1203774642 EBV:65938-65960 CCTTCTACCCCTTCTATGCCAAT No data
Right 1203774646 EBV:65951-65973 CTATGCCAATGCGTCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774642 Original CRISPR ATTGGCATAGAAGGGGTAGA AGG (reversed) Intergenic