ID: 1203774643

View in Genome Browser
Species Human (GRCh38)
Location EBV:65945-65967
Sequence TGGACGCATTGGCATAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774643_1203774658 27 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774643_1203774654 9 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774643_1203774650 -2 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774650 EBV:65966-65988 CACCAAGGTCACCAACAAGGAGG No data
1203774643_1203774648 -5 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data
1203774643_1203774655 18 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774643_1203774652 1 Left 1203774643 EBV:65945-65967 CCCCTTCTATGCCAATGCGTCCA No data
Right 1203774652 EBV:65969-65991 CAAGGTCACCAACAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774643 Original CRISPR TGGACGCATTGGCATAGAAG GGG (reversed) Intergenic