ID: 1203774645

View in Genome Browser
Species Human (GRCh38)
Location EBV:65947-65969
Sequence GGTGGACGCATTGGCATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203774645_1203774652 -1 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774652 EBV:65969-65991 CAAGGTCACCAACAAGGAGGAGG No data
1203774645_1203774655 16 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774655 EBV:65986-66008 AGGAGGCCCTTAGGCCAAACCGG No data
1203774645_1203774658 25 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774658 EBV:65995-66017 TTAGGCCAAACCGGTCTTTTTGG No data
1203774645_1203774654 7 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774654 EBV:65977-65999 CCAACAAGGAGGAGGCCCTTAGG No data
1203774645_1203774650 -4 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774650 EBV:65966-65988 CACCAAGGTCACCAACAAGGAGG No data
1203774645_1203774648 -7 Left 1203774645 EBV:65947-65969 CCTTCTATGCCAATGCGTCCACC No data
Right 1203774648 EBV:65963-65985 GTCCACCAAGGTCACCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203774645 Original CRISPR GGTGGACGCATTGGCATAGA AGG (reversed) Intergenic
No off target data available for this crispr